Labshake search
Citations for Qiagen :
451 - 500 of 4345 citations for Trisodium dichloroanthra 2 1 9 mna naphth 2 3 h acridine 5 10 15 triyl tris sulfate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... denaturation solution (0.2M NaOH), and wash buffer (10 mM Tris-acetate, pH 7.6) using the PyroMark Q96 Vacuum Workstation (QIAGEN). Purified DNA resuspended in annealing buffer (20 mM Tris-acetate pH7.6 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Genomic DNA was extracted 96h after transfection using homemade cell lysis buffer (10 mM Tris-HCl pH8.5 and 0.05% SDS) or DNeasy Blood & Tissue Kits (Qiagen) to evaluate editing frequencies ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... root or shoot tissues were ground in 2 mL tubes (Qiagen) containing 3 chrome steel beads of 3.2 mm diameter (BioSpec Products ...
-
bioRxiv - Microbiology 2024Quote: ... for 2 hours and purified using QIAquick PCR Purification Kit (Qiagen). Guide RNA sequence was ordered as oligos (Tm = 51°C ...
-
bioRxiv - Microbiology 2024Quote: ... cells were treated with 2× volume of RNAprotect Bacteria Reagent (QIAGEN) for 10 min at room temperature and collected as pellets by centrifugating for 10 min at 5,000×g ...
-
bioRxiv - Genomics 2024Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Genomics 2024Quote: ... 2 ml of RNAprotect® Bacteria Reagent (cat # 76506, Qiagen Inc.) was added ...
-
bioRxiv - Microbiology 2024Quote: ... 48 h and 72 h treatment using RNeasy Kit (Qiagen) and mRNA expression levels of Ribosomal Protein L13a (RPL13A) ...
-
bioRxiv - Cell Biology 2023Quote: ... Cleared lysate was briefly incubated (approximately 5 min) with 3 ml Ni-NTA Agarose (QIAGEN) before flow-through was collected ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR mix contained 0.16 µM of each of the fluorescent universal primer and of the reverse specified primer and 0.04 µM of the 5’ tail forward primer in a final 15 µl reaction volume (2x QIAGEN Multiplex PCR Master Mix with 3 mM Mg2+ ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated for 1 h at 55°C with 20 mg ml−1 proteinase K (Qiagen). Samples were treated for 10 min at 65 °C with 4 μl RNase A (100 mg ml−1 ...
-
bioRxiv - Microbiology 2021Quote: ... 6 and 9 employing the RNeasy plant mini kit (Qiagen). RNA was quantified using Nanodrop (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18S rRNA gene was used as internal control for normalization ...
-
ST6GAL1-mediated heterogeneity in sialic acid levels potentiates invasion of breast cancer epitheliabioRxiv - Cancer Biology 2020Quote: ... Real time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18 S rRNA gene was used as internal control for normalization ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA-SARC-CoV-2 Wuhan-Hu-1 P681H S plasmid was then extracted using the QIAprep Spin Miniprep Kit (Qiagen N.V.) and Sanger sequencing was used to confirm incorporation of the mutation.
-
bioRxiv - Genomics 2022Quote: ... Trachea was dissected and immersed in 1 mL PBS in a 2 mL microcentrifuge tube (Fisherbrand, 14-666-315) containing one stainless steel bead (QIAGEN, 69989). After the homogenization ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA was extracted from cells (1-2 wells, 6 well plate) using an RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), including a DNase step to remove residual DNA ...
-
bioRxiv - Synthetic Biology 2020Quote: ... For SARS-CoV-2 antigen detection the blots were incubated with 1:2000 Anti-His mouse monoclonal primary antibody (Qiagen, #34660) and then incubated with 1:10000 peroxidase labelled anti-mouse IgG secondary antibody (GE Healthcare) ...
-
bioRxiv - Neuroscience 2021Quote: ... Amplicons were separated on a 1-2% agarose gel and appropriate bands were excised and isolated using a gel extraction kit (Qiagen, USA). These fragments were inserted into the pcDNA3.1-based plasmid or cFUGW lentivirus vector using the T4 ligase (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... or remaining mosquito bodies were collected separately in a 2ml Eppendorf Safe Lock tube with 250μl DMEM (2% FBS, 1% Sodium Pyruvate) with 25 mg/ml Amphotericin B and a stainless steel bead (Qiagen, Hilden, Germany). Samples were stored at −80°C.
-
bioRxiv - Cancer Biology 2023Quote: DNA was extracted from NCI-PC35-1 and NCI-PC35-2 organoids using an AllPrep DNA/RNA Mini Kit (Qiagen 80204) according to the manufacturer’s protocol for animal cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... were homogenised in QIAzol reagent (1 mL) in a 2 mL safe lock tube with stainless steel beads using a TissueLyser II homogeniser (Qiagen, UK) at 30 Hz until fully homogenised (1-2 min) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... log-phase cells in the range of 1–2 × 108 cells using the Qiagen DNeasy® Blood and Tissue kit (Qiagen). We resuspended the genomic DNA in 10 mM Tris-HCl pH 8.5 and stored it at 4° until submission to the McDonnell Genome Institute at Washington University in St ...
-
bioRxiv - Cancer Biology 2024Quote: Genomic DNA was isolated from each KPC-1 and KPC-2 derived monoclonal line using a DNeasy Blood and Tissue kit (Qiagen 69504) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: 1-3 × 105 PBMCs were lysed in QIAzol (Qiagen). Full-length cDNA was then synthesized using the SMARTer technology (Takara Bio) ...
-
bioRxiv - Physiology 2023Quote: RNA was extracted from 10-15 mg of powdered frozen heart tissue (RNeasy Fibrous Tissue Mini Kit, Qiagen) and used for cDNA synthesis (QuantiTect Reverse Transcription Kit ...
-
bioRxiv - Genomics 2022Quote: ... DNA fragments were released by addition of 15 µL 10% SDS and 30 µL Proteinase K (Qiagen, #19133) to each tube followed by incubation at 50°C for 3h ...
-
bioRxiv - Genomics 2020Quote: ... 0.4 M NaOH and 10 mM Tris-acetated (pH 7.6) and then hybridized to the sequencing primer in PyroMark annealing buffer (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The centrifugation step was repeated and the pellet air-dried before the DNA was dissolved in 10 mM Tris-HCl (pH 8.5, Qiagen) at 65 °C for 20 min ...
-
bioRxiv - Microbiology 2020Quote: ... We eluted purified DNA in 45 µl of EB buffer (10 mM tris-hydrochloride (pH 8.0) (Qiagen, The Netherlands) supplemented with 0.05% (v/v ...
-
bioRxiv - Immunology 2021Quote: ... or ectodomain buffer (20 mM Tris, pH 8.5, 500 mM NaCl) and applied to 10 ml Ni-NTA-Sepharose (Qiagen) columns ...
-
bioRxiv - Microbiology 2022Quote: ... then 5 µl of RNAse A (10 mg/ml; Qiagen, Hilden, Germany) was added and the sample was incubated for 30 min at 37 °C ...
-
bioRxiv - Immunology 2023Quote: ... The first round of PCR was carried out using the ImmunoSEQ proprietary PCR primer mix (32 μL per sample containing 25 uL of QIAGEN 2× Multiplex PCR Master Mix, 5μL of QIAGEN 5x Q-solution and 2 μL of primer mix). A positive control reaction ...