Labshake search
Citations for Qiagen :
451 - 500 of 1071 citations for Recombinant Human IgG1Fc Protein Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... protein was captured using Ni-NTA affinity chromatography (Qiagen). Protein was further purified using ion exchange chromatography preceding size exclusion chromatography on a HiLoad 16/600 Superdex 75 prep grade column (GE Healthcare ...
-
bioRxiv - Biochemistry 2024Quote: ... protein purification was performed using Co+NTA agarose (Qiagen), followed by a Phenyl Sepharose column ...
-
bioRxiv - Cell Biology 2020Quote: ... and 20 ng of cDNA used for qPCR with the human miFinder miRNA Array (Qiagen). The PCR was done with the following cycling conditions ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Biophysics 2019Quote: ... The human full-length GRASP55 was loaded on to the Ni-NTA superflow column (QIAGEN) and then eluted with 300 mM imidazole in lysis buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... Reads were mapped to the human genome (hg38) using CLC Genomics Workbench (Qiagen, Hilden, Germany) and data was analysed using HOMER (Hypergeometric Optimization of Motif EnRichment ...
-
bioRxiv - Cancer Biology 2020Quote: ... using a Human Cancer Pathway Finder miScript miRNA PCR Array(Cat # MIHS-102ZF, 331221-Qiagen). Expression of miR-181a was validated by q-PCR using primers (cat # MS00008827 ...
-
bioRxiv - Physiology 2021Quote: Total RNAs were obtained from human UREC or mouse kidneys using RNeasy Mini Kit (Qiagen) and reverse transcribed using SuperScript II Reverse Transcriptase (Life Technologies ...
-
bioRxiv - Immunology 2022Quote: ... For RT2 Profiler PCR Array Human Interferons and Receptors (Cat# PAHS064ZC-12, Qiagen, Germantown, MD), RNA extraction (RNeasy Pls Mini kit ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was extracted from human organoids using RNeasy Mini Kit with DNase treatment (QIAGEN), and synthesis of cDNA was conducted with High-Capacity cDNA Reverse Transcription Kit (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from human or murine cells using the RNeasy Mini Kit (Qiagen), and cDNA synthesized from 1 µg total RNA (High Capacity cDNA Reverse Transcription Kit ...
-
bioRxiv - Immunology 2020Quote: ... total mRNA was isolated from mouse and human B cells by RNeasy Micro kit (Qiagen), reverse transcribed from mRNA to cDNA for subsequent real-time PCR analysis ...
-
bioRxiv - Microbiology 2019Quote: ... The siRNAs were part of a human whole-genome library obtained from Qiagen (Hilden, Germany) deposited at the Max Planck Institute for Infection Biology (Berlin ...
-
bioRxiv - Physiology 2020Quote: ... RNA from human islets (∼150 for each donor) was extracted with RNeasy Mini Kit (Qiagen) and was reverse transcribed using the High Capacity Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA was extracted from human tissue and cells using the miRNeasy Mini kit (Qiagen) or TRIzol reagent (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2020Quote: ... For the RT² Profiler™ PCR Array Human Epithelial to Mesenchymal Transition kit (EMT) (Qiagen), RNA integrity of all the samples was tested by using the Agilent RNA 6000 Nano kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2022Quote: Two siRNAs targeting human PRMT5 (FlexiTube siRNA Hs_PRMT5_1, cat#SI04216492 and Hs_PRMT5_2, cat# SI04248951, Qiagen) were used for knockdown experiments in HEK 293T cells ...
-
bioRxiv - Microbiology 2023Quote: ... total RNA was extracted from sorted infected primary human hepatocytes using miRNeasy Micro Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: RNA was extracted from human primary cells using AllPrep RNA/RNA/miRNA universal kit (Qiagen) according to manufacturer instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... human PAAS proteome was imported into Ingenuity Pathway Analysis (IPA) software (QIAGEN, 2020 released version)[84] for canonical pathway analysis ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from pigskin and human skin swabs using a DNeasy PowerSoil kit (Qiagen). Procedural extraction control blanks (swabs with sterile water ...
-
bioRxiv - Immunology 2023Quote: Human nasal swab samples were inactivated with 350 µls RLT buffer (Qiagen, Cat No. 79216) containing 1% β-mercaptoethanol for a minimum of 10 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... and human islets was isolated using RNeasy Mini or Micro kits (Qiagen, Valencia, CA, USA). Reverse transcription was performed using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from sampled human brains using miRNeasy Mini Kit (Qiagen, CA, USA). The tissue samples were homogenized in QIAzol (Qiagen ...
-
bioRxiv - Cell Biology 2024Quote: ... The autophagy screening was performed using the RT2 Profiler™ PCR Array Human Autophagy (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2019Quote: ... Lysates were incubated for 1 hr at 37°C after adding 10 µl of RNAse A (20 mg/ml) and proteins were precipitated with 200 µl of Protein Precipitation Solution (Qiagen Gentra Puregen Cell kit). After centrifugation ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein was purified using Ni-NTA Fast Start (Qiagen, #30600) according to the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2021Quote: ... refolded protein mixture was loaded on Ni-NTA beads (Qiagen) as 1ml per 2 liter culture ...
-
bioRxiv - Neuroscience 2019Quote: ... for protein extraction or 200 µL of RLT buffer (Qiagen) for RNA extraction and stored at −80°C until further sample processing.
-
bioRxiv - Biochemistry 2019Quote: ... Proteins were purified by Ni2+-affinity (Ni-NTA agarose, Qiagen) then passed over an anion-exchange column (Hitrap Q HP ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein was affinity-purified using Ni-NTA agarose (Qiagen #301210), and exchanged into severing buffer I (SBI ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein crystallization was screened for in commercially available screens (Qiagen), using a Crystal Gryphon robot (Art Robbins Instruments) ...
-
bioRxiv - Microbiology 2021Quote: ... The protein was purified using Ni-NTA affinity columns (Qiagen) and subsequently purified by gel filtration using a HiLoad Superdex 75 pg column (GE) ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were then purified using Ni-NTA agarose (Qiagen 30210). The amount of purified protein was estimated both by conducting BCA assays (Thermo Fisher 23225 ...
-
YAP promotes cell-autonomous immune responses to tackle intracellular Staphylococcus aureus in vitrobioRxiv - Cell Biology 2022Quote: ... RNA was extracted using the Allprep RNA/Protein Kit (Qiagen). The quality and quantity of RNA were assessed using the Experion RNA Analysis Kit (BioRad ...
-
bioRxiv - Immunology 2019Quote: ... Proteins were purified by affinity chromatography on NiNTA agarose (Qiagen), followed by FPLC on MonoQ (GE Healthcare ...
-
bioRxiv - Biochemistry 2019Quote: ... The protein was isolated by Ni-NTA affinity chromatography (Qiagen) and eluted with 50 mM Tris buffer pH 7.5 ...
-
bioRxiv - Synthetic Biology 2020Quote: Protein purification was done using Ni-NTA Spin Columns (Qiagen) following the supplier recommendations ...
-
bioRxiv - Cancer Biology 2020Quote: ... or the AllPrep DNA/RNA/Protein mini kit (Qiagen #80004) and quantified using 2100 Bioanalyzer (Agilent) ...
-
bioRxiv - Microbiology 2020Quote: ... The proteins were purified using Ni-NTA agarose resin (Qiagen), washed with 20 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2019Quote: ... proteins were affinity purified on Ni-NTA agarose beads (Qiagen). Proteins eluted from Ni-NTA beads by stepwise addition of increasing concentrations of 50-300 mM imidazole in a buffer containing 20 mM HEPES pH 7.4 ...
-
bioRxiv - Immunology 2021Quote: ... and the resulting proteins were purified using Ni-resins (Qiagen) and size exclusion chromatography (HiLoad Superdex 75 ...
-
bioRxiv - Immunology 2021Quote: ... and the resulting proteins were purified using Ni-resins (Qiagen). The vector encoding a hexa-His tag fused to a single chain homotrimeric mLIGHT extracellular domain (G73-V239 ...
-
bioRxiv - Bioengineering 2022Quote: ... Pan-Fzd protein was purified using Ni-NTA Agarose (Qiagen), followed by biotinylation and size-exclusion chromatography with a Superdex S75 column (GE Healthcare) ...
-
bioRxiv - Neuroscience 2022Quote: Protein phosphorylation assay was performed using PhosphoProtein Purification Kit (Qiagen), exactly as described by manufacture’s guideline ...
-
bioRxiv - Cell Biology 2022Quote: ... KASH5 fusion proteins were purified through consecutive Ni-NTA (Qiagen), amylose (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: ... Protein alignment was performed with CLC Genomics Workbench 22.0.1 (Qiagen) using MUSCLE v3.8.425 (Edgar ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were incubated with Ni-NTA Agarose (Qiagen, Cat#30230) resin for 30 min at 4 °C in a beaker with stirring ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were purified by Ni2+-affinity (Ni-NTA agarose, Qiagen) then passed over an anion-exchange column (Hitrap Q HP ...
-
bioRxiv - Microbiology 2023Quote: Plasmids used for protein purification were based on pQE70 (Qiagen). For purification of EsaDEG ...