Labshake search
Citations for Qiagen :
451 - 500 of 666 citations for Phospholipase A and Acyltransferase 4 RARRES3 PLAAT4 Antibody Biotin since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from ten 4-mL aliquots of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104).
-
bioRxiv - Pathology 2024Quote: ... by running one homogenization cycle (50 Hz oscillation frequency (50 cycles/s) for 4 minutes) in a Tissue lyser LT (Qiagen). Tubes were then centrifuged at 5000 rpm for 5 min ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...
-
bioRxiv - Immunology 2024Quote: ... Cytosolic fractions were prepared by centrifugation at 10,000 × g for 30 min at 4°C and DNA was isolated from them using the DNeasy Blood & Tissue kit (Qiagen). The copy number of mitochondrial DNA encoding 16S RNA (RNR2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the supernatant was added to a 500 μl equilibrated Glutathione Sepharose 4 Fast Flow affinity medium (GE) or Ni-NTA agarose (Qiagen). The lysate was incubated with an affinity matrix for 1 hour at 4 ⁰C ...
-
bioRxiv - Genomics 2024Quote: ... Digested product was then run on a 4% agarose gel with 1x SYBR Safe for 45 minutes at 100 V and gel extracted (Qiagen).
-
bioRxiv - Microbiology 2024Quote: ... Lysates were centrifuged for 30 min at 30000 x g in 4 °C and the resulting supernatants were gently mixed with Ni-NTA Agarose beads (Qiagen) pre-equilibrated with lysis buffer ...
-
bioRxiv - Genomics 2024Quote: ... Fosmid clones from the WIBR-1 library were purchased from the BACPAC Resources Center (for coordinates and names, see Supplementary Table 4) and isolated using Large-Construct Kit (Qiagen).
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are harvested by centrifugation (5 minutes, 4°C) and washed with 1 ml cold PBS containing RNA stabilization reagents (RNAprotect, Qiagen) before flash freezing and storage at -80°C ...
-
bioRxiv - Biochemistry 2024Quote: ... Lysed cells were sedimented by centrifugation at 20,000 RCF at 4 °C for 30 min and the lysate was subsequently loaded onto pre-equilibrated Ni-NTA agarose resin (Qiagen) at 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... The cell pellet was removed after centrifugation (16000 rpm, 4 °C, 1 h) and supernatant was loaded into a Ni-NTA agarose column (Qiagen). Protein was eluted in an elution buffer (50 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2024Quote: ... Total RNA was extracted from the supernatant (12,000 x g for 10 min at 4°C) of centrifuged tissue homogenate using an RNeasy Mini Kit (Qiagen, USA). The extracted total RNA was used for single-strand cDNA synthesis ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated for 30 min at 4 °C with 5 mL of Ni2+-beads (Qiagen Ni-NTA Superflow) equilibrated in lysis buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... freshly sorted cells were pelleted at 500 g for 10 minutes at 4° and then resuspended in RLT Plus buffer (Qiagen). Cells were vortexed and frozen for at least one day at −80° before being thawed on ice and processed for RNA using an RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the chromatin incubated at 67 °C for 4 h following a purification step with the QIAquick PCR Purification kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... beads were discarded and the supernatant containing reconstituted into ND A2AAR was incubated for 4 h with 250 µL of Ni-NTA resin (Qiagen) for separating from empty ND ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was isolated from fecal matter and gastrointestinal sections using the DNeasy HTP 96 PowerSoil Kit (Qiagen, 12955-4). All DNA was recovered in ultrapure water without additives and stored at −20 °C.
-
bioRxiv - Biochemistry 2023Quote: ... the cell lysate was cleared by centrifugation (20L000 rpm, 30 minutes, 4 °C) and purified using Ni+2-affinity chromatography (Ni-NTA superflow cartridges, Qiagen). Typically two 5 mL columns (flow 5 mL/min ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Biochemistry 2023Quote: ... Filters were incubated at 55°C for approximately 4 h and the resulting lysates were purified with the DNeasy kit (Qiagen) using a slightly modified protocol49 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Prior to RNA extraction individuals were homogenized in 200 μl homogenization buffer including 4 μl 1-Thioglycerol using a TissueLyser II (Qiagen) with a mixture of five 1 mm zirconia (BioSpec Products ...
-
bioRxiv - Developmental Biology 2023Quote: ... Supernatants were separated from lysates and incubated with affinity beads at 4°C overnight (His beads: Ni-NTA from QIAGEN; GST beads ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from the hippocampus of P65 females of all four groups (n=4/group) using the RNeasy Midi Kit (Qiagen). RNA samples were submitted to the University of Minnesota Genomics Center for library preparation and sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... Template DNA was degraded using RQ1 DNAse for 30 min at 4°C and RNA was purified using RNAeasy mini kit (Qiagen). 4-week-old NRG mice were injected intra-hepatically using 10 µg of RNA in a maximum volume of 50 µL of PBS+RNA and one week post injection a terminal bleed was performed ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Neuroscience 2023Quote: ... The remaining cells were pelleted at 1000 x g for 10 minutes at 4°C and lysed in 350 µL of Buffer RLT (Qiagen) supplemented with 3.5 µL of 2-β mercaptoethanol (#444203 ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting total cell lysate was clarified by centrifugation (30,000 g for 25 min) and the supernatant fraction was applied to a 4 mL packed Ni-NTA resin (Qiagen) and gently rocked at 4 °C for 1.5 h in 50 mL conical tubes ...
-
bioRxiv - Biochemistry 2023Quote: A kinome-wide siRNA library that contained 4 individually arrayed siRNA sequences in 384-well plates was purchased from Qiagen. The library consisted of known kinases and associated proteins ...
-
bioRxiv - Microbiology 2023Quote: ... Sample DNA was extracted from microbiome samples using the PowerSoil DNA extraction kit (Cat. No. 12955-4, Qiagen, Valencia, California). Marker genes in isolated DNA were polymerase chain reaction (PCR)-amplified using GoTaq Master Mix (Cat ...
-
Sweetwater: an underrated crude glycerol for sustainable lipid production in non-conventional yeastsbioRxiv - Systems Biology 2023Quote: ... tubes were vortexed for 15 s and submitted to cell disruption for 15-min at 4°C using a TissueLyser II (Qiagen) at 30 Hz ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were selected in puromycin (1 μg/ml) the next day and after 4 days genomic DNA was extracted using DNeasy Blood and Tissue kit (Qiagen). Genomic DNA was sonicated to an average size of 500 bp using S2 Focused-ultrasonicator (Covaris ...
-
bioRxiv - Neuroscience 2023Quote: ... Amplicons were size-verified on a 4% agarose gel and PCR amplicons were extracted and purified (Qiaquick Gel Extraction Kit, Qiagen) before indexing (Nextera XT ...
-
bioRxiv - Pathology 2023Quote: ... tissue and cells were lysed in RIPA lysis buffer supplemented with orthovanadate and a cocktail of protease inhibitors at 4°C (using a TissueLyser (Qiagen) to homogenize liver tissue ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting total cell lysate was clarified by centrifugation (30,000 g for 25 min) and the supernatant fraction was applied to a 4 mL packed Ni-NTA resin (Qiagen) and gently rocked at 4 °C for 1 h in 50 mL conical tubes ...
-
bioRxiv - Microbiology 2023Quote: ... Lysates were centrifuged for 30 min at 38,000 g and 4°C and cleared supernatants loaded onto Ni-NTA columns with 0.5 mL bed volume (1018244 Qiagen, Germany). The columns were washed sequentially with 3 column volumes (CV ...
-
bioRxiv - Microbiology 2023Quote: ... Pellets were washed in 2 mL cold 10 mM NaCl + 4 mL cold RNAprotect Bacteria Reagent (Qiagen Cat. No. 76506) and repelletted at 4,255 x g ...
-
bioRxiv - Developmental Biology 2023Quote: ... Then samples and inputs were incubated for 4 hr at 37°C with 1.5 µl of 10 mg/ml RNase A (Qiagen, 1007885) and 15 µl 10% sodium dodecyl sulfate and 3.5 µl 20 mg/ml Proteinase K (Thermo Fisher ...
-
bioRxiv - Microbiology 2024Quote: ... The cell lysates were centrifuged at 10000 g for 30 min at 4 °C and the clear supernatant was collected and passed through Ni-NTA agarose column (Qiagen). Contaminating proteins were washed away by passing a 20–120 mM imidazole gradient through the column while the bound toxins were eluted using PBS containing 500 mM imidazole ...
-
bioRxiv - Cell Biology 2024Quote: RNA was isolated from ciDKO podocytes (3 days after Cre lentiviral transduction) and wild-type control cells (n=4 for each group) using an RNeasy mini kit (Qiagen). RNA was quantified using a Qubit Fluorimeter (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2024Quote: ... and then spun down 4 ml of the culture before proceeding to isolation of the final plasmid using a QIAprep Spin Miniprep kit (Qiagen). The samples were stored at 4 °C ...
-
bioRxiv - Microbiology 2024Quote: DNA extraction was carried out from 300 μL culture pellets using the DNeasy UltraClean 96 Microbial Kit (Qiagen 10196-4). Subsequent library preparation and sequencing were conducted at the NGS Competence Center NCCT (Tübingen ...
-
bioRxiv - Physiology 2024Quote: ... RNA was isolated from pooled vessels (4 renal arteries or 2 mesenteric arteries) using the RNeasy Micro kit (Qiagen, USA), quantified by the NanoDrop-1000 (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... were immediately placed in RNAlater during dissection and stored at 4 degrees Celsius until RNA isolation using the RNeasy Mini Kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Culture supernatant containing His-tagged NTD protein was harvested 4 days after transfection and was purified using Ni-NTA resin (Qiagen). Spike protein was further purified with a Superose 6 Increase 10/300 GL column equilibrated with 20 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Molecular Biology 2024Quote: ... was reverse transcribed at 37 °C for 2 h in a 20 μL reaction volume containing 4 U of Omniscript reverse transcriptase (Qiagen), 0.5 mM each dNTP ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was eluted in 100 µL of TE-0.5% SDS buffer with Proteinase K at 60 °C for 4 hours and purified using the MiniElute PCR purification kit (Qiagen).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Digoxigenin (DIG)-labelled probes were denatured at 90°C for 4 min and diluted with 1 x microRNA ISH buffer (Qiagen), following protocol by Endisha & Kapoor ...
-
bioRxiv - Genomics 2024Quote: ... The pooled cells were centrifuged at 500 × g for 5 minutes at 4°C and resuspended in 100 μl of buffer EB (Qiagen).
-
bioRxiv - Immunology 2024Quote: Bladders were weighed and homogenized in 1 mL of sterile PBS at 4°C using a handheld rotor-stator tissue homogenizer (TissueRuptor II, Qiagen). Homogenates were serially diluted ...
-
bioRxiv - Genomics 2024Quote: Ten aphids (n = 10 × 4) were ground to powder with a liquid nitrogen-cooled micropestle after which the RNeasy kit (Qiagen) was used for RNA extraction with on-column DNA digestion (Qiagen) ...