Labshake search
Citations for Qiagen :
451 - 500 of 2047 citations for N Furan 2 ylmethyl 3 bromo 4 fluoro benzamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... tailbuds were individually lysed in 3 μL of RLT + BME (Qiagen RNeasy) and stored in separate PCR tubes at −80 °C to await genotyping of heads (for rad21-/- and rad21+/-) ...
-
bioRxiv - Cell Biology 2024Quote: ... mRNA was isolated from 3 dpf TL embryos (RNeasy, Qiagen; RNAlater, Invitrogen), and AffinityScript QPCR cDNA Synthesis Kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... or p300 (Qiagen, Sequence: 5′-TAG TCT GGT CCT TCG T-3′) for 24hr ...
-
bioRxiv - Genomics 2024Quote: ... 1 µL (50U) of high-concentration klenow 3’-5’ exo-polymerase (Qiagen) was added ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then applied to a 3 mL Ni-NTA (Qiagen) column ...
-
bioRxiv - Pathology 2021Quote: ... RNA was extracted using RNeasy Mini Kit (Qiagen 741-4) per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... and WNT signaling targets PCR array (Qiagen, PAMM 243ZE-4) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... siRNAs were selected among FlexiTube GeneSolution 4 siRNA sets (Qiagen) and reordered after validation as dTdT-overhanging 19 nt RNA duplexes (Thermo) ...
-
bioRxiv - Microbiology 2020Quote: ... 4) Powersoil® Isolation kit (MO Bio Laboratories/Qiagen, Canada) by the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... and subsequently normalized to 4 nM using elution buffer (Qiagen) with 0.1% Tween20 (Sigma) ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... and SFPQ siRNA #2 (Qiagen Cat#SI05783876) at 40 nM using Lipofectamine RNAiMax transfection reagent (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... 2 ml RNAprotect Bacteria Reagent (Qiagen, Hilden) was added to each filter and incubated for 15 min at room temperature before vacuuming through the filter ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... U6 snRNA (2 nM-positive control; Qiagen) or scramble control probe (40 nM – negative control ...
-
bioRxiv - Genomics 2024Quote: ... 2 µl Proteinase K (Qiagen, RP107B-1) and 5 µl water was added to each tube with 5 µl sub-library for a final volume of 20 µl per reaction ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was extracted and 5 μg reverse transcribed from paired isolated Jz and Lz placental tissues (n = 8-10 per genotype/sex, across 11 litters) using the RNeasy Plus Mini Kit (Qiagen, DE) and the High-Capacity cDNA Reverse Transcription Kit minus RT inhibitor (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was isolated from batches of embryos, ICM or TE (n = 20) using PicoPur Arcturus (Excilone, France) with a DNase I (Qiagen, Germany) treatment as recommended by the supplier ...
-
bioRxiv - Neuroscience 2020Quote: ... RAGE-/- and SOD1G93A x RAGE-/- mice (n = 5 - 6) using RNeasy Lipid Tissue extraction kit according to manufacturer’s instructions (QIAGEN, CA, USA). The total RNA was purified from genomic DNA contamination using Turbo DNase treatment (Ambion ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was ground inside a microtube with a stainless steel pestle until finely powdered and a N-phenacylthiazolium bromide (PTB) and Qiagen Plant DNEasy® Mini Kit (Qiagen)-based protocol was used to isolate the DNA18 ...
-
bioRxiv - Cancer Biology 2021Quote: ... normal tissue or n=30 embryos at 20 hours post fertilization was used as input to the RT2 HT First Strand Kit (Qiagen #330411) to reverse transcribe cDNA ...
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted from the colon tissue of mice (n=5) by using the RNeasy mini kit (Cat# 74104, Qiagen, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Physiology 2022Quote: ... liver and eWAT samples (n=6 per group) were extracted using RNABle lysis reagent (Eurobio) and the RNeasy® Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA from hippocampus samples (n=6 per group) was extracted using RNABle lysis reagent (Eurobio) and the RNeasy® Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from FFPE tumor cores (n= 12 samples) using RNeasy FFPE kits according to the manufacturer’s protocol (QIAGEN, Germantown, MD). RNA-seq libraries were generated using Truseq RNA Access Library Prep Kits (TruSeq RNA Exome kits ...
-
bioRxiv - Neuroscience 2024Quote: RNA extraction was performed on N=31 homogenized half-brain tissue aliquots using the RNeasy Plus Micro Kit (QIAGEN, Germantown, MD). Tissue aliquots were homogenized in 350 µl QIAGEN Buffer RLT Plus using a Qiagen TissueLyser LT and centrifuged for 3 min at maximum speed ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was extracted from initial and exponential growth phase cultures grown on different N sources using a DNeasy PowerSoil Pro DNA isolation kit (QIAGEN, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: Total DNA was extracted from mouse parotid gland tissue (n=5/group) following the manufacturer’s protocol for DNeasy Blood & Tissue Kit (Ref. No. 69504, Qiagen, Hilden, Germany). Mitochondrial DNA (mtDNA ...
-
bioRxiv - Biochemistry 2024Quote: ... the EcNhaA triple mutant was extracted from membranes with n-Dodecyl β-D-maltoside (DDM; Glycon) and purified by Ni-nitrilotriacetic acid (Ni-NTA; Qiagen) affinity chromatography ...
-
bioRxiv - Neuroscience 2020Quote: ... from APP/PS1 and NTG mice treated with vehicle of CP2 for 14 months (n = 5 per group) were lysed in QIAzol (Qiagen cat. # 79306) followed by RNA isolation using miRNeasy (Qiagen cat ...
-
bioRxiv - Neuroscience 2020Quote: Genomic DNA was isolated from snap-frozen cortico-hippocampal brain sections from NTG and APP/PS1 mice treated with vehicle or CP2 (n = 5 per group) for 14 months using a DNeasy Blood & Tissue Kit (QIAGEN, cat. # 69504) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... The RBD wildtype and mutant proteins of SARS-CoV-2 spike with 10×his tag at N terminal were expressed in HEK 293 and purified with Ni-NTA affinity columns (Qiagen, Hilden, Germany).
-
bioRxiv - Microbiology 2020Quote: DNA was individually extracted from the head and abdomen of all mosquito specimens (n=112) using the QIAamp DNA tissue extraction kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... was extracted from the blood (N. scutatus) or tail clip (P. textilis) using the genomic-tip 100/G kit (Qiagen, Hilden, Germany). This was performed with proteinase K (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... and isolated keratinocytes and fibroblasts from the skin and Wound7 (n = 5/each group) (Table 1 and Table S1) by using the miRNeasy Mini kit (Qiagen, Hilden, Germany) and prepared for library construction ...
-
bioRxiv - Physiology 2023Quote: Total RNA and miRNA was extracted from liver and distal intestine (n = 6 per condition) using a miRNeasy Tissue/Cells Advanced Mini Kit (Qiagen, Hilden, Germany) following the protocol provided by the manufacturer ...
-
bioRxiv - Cancer Biology 2024Quote: ... and AR DBD domain DNA fragment were cut by NheI (N-terminal) and XhoI (C-terminal) and purified with the QIAquick Gel Extraction Kit (Qiagen; cat. 28704). After ligation with T4 DNA Ligase (New England ...
-
bioRxiv - Physiology 2023Quote: ... proximal intestine and distal intestine (n = 6 per sampling day and diet) according to the miRNeasy Tissue/Cells Advanced Mini Kit protocol (Qiagen, Hilden, Germany). RNA was treated with the Turbo DNA-free kit (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: Parotid glands were removed from mice (n=5/group) and total DNA was immediately isolated using the DNeasy Blood & Tissue Kit (Ref. No. 69504, Qiagen, Hilden, Germany). DNA samples were diluted with nuclease-free water to a concentration of 10 ng/uL ...
-
bioRxiv - Developmental Biology 2024Quote: ... E17 and P0 (n=6 embryos per sex and time point) using the Qiagen miRNeasy mini kit (CatNo. 217004; Qiagen; Hilden, Germany). 500 ng of total RNA ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA isolated from 3-week-old thalli (QIAGEN RNAeasy Plant Kit 5) from each genotype was assessed for quality with a Nanodrop spectrophotometer and a Bioanalyzer 2100 microfluidics system (Agilent 6) ...
-
bioRxiv - Cancer Biology 2021Quote: ... or miR-200b/200c on the ZC3H11A 3’UTR were obtained from Qiagen. TSBs were resuspended in ddH2O to prepare a 50 µM solution ...
-
bioRxiv - Biochemistry 2021Quote: ... The sample was then loaded onto 3 ml of Ni-NTA resin (Qiagen) by gravity at 4°C ...
-
bioRxiv - Pathology 2021Quote: PDGFRα+ and CD56+ cells (passages 3 to 5) were lysed in Qiazol (Qiagen) followed by chloroform/isopropanol total RNA extraction ...