Labshake search
Citations for Qiagen :
451 - 500 of 539 citations for GPHN siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Control cells were transfected in parallel with control siRNA (siCtrl) purchased from QIAGEN (Germantown, MD).
-
bioRxiv - Cell Biology 2022Quote: ... All the siRNA sequences used in the study were previously validated sequences: siControl (Qiagen, GGACCTGGAGGTCTGCTGT) and siSeparase (Dharmacon ...
-
bioRxiv - Immunology 2022Quote: ... siRNA-transfection reagent complexes were generated using 2 μL HiPerfect transfection reagent (Qiagen, Germantown, MD) and 25-50 nM siRNA (non-specific control siRNA (sc-37007 ...
-
bioRxiv - Microbiology 2023Quote: ... As a negative control for our transfections we used a non-targeting siRNA from Qiagen (SI03650318 ...
-
bioRxiv - Cancer Biology 2023Quote: HIF-2α or ALYREF were knocked down in 786-O cells using FlexiTube siRNAs (Qiagen) and compared to a non-targeting siRNA control (Qiagen Allstars Neg Ctrl) ...
-
bioRxiv - Cancer Biology 2023Quote: 2 × 105 cells were reverse-transfected in 6-well plates with Flexitube siRNA constructs (Qiagen) targeting KEAP1 (KEAP1_5 or KEAP1_8) ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 μl of siRNAs were mixed with 37.5 μl of Hiperfect transfection reagent (301707, Qiagen) and enough Optimem Opti-MEM reduced serum medium (31985070 ...
-
bioRxiv - Cell Biology 2024Quote: ... NHEKs were transfected with FLG siRNA and the non-targeting control using HiPerFect (Qiagen,UK). For transfection ...
-
bioRxiv - Cell Biology 2022Quote: siRNA duplex for IPO9 was obtained from Ambion (id# S31299) and siRNA for the nuclear actin exporter XPO6 was obtained from Qiagen (id# SI00764099). All siRNA were transfected or co-transfected with emerin plasmids at 25 nM using X-tremeGENE HP (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAT3 (M-003544-02) or non-targeting AllStars negative control siRNA (1027280) were purchased from Qiagen or Dharmacon ...
-
bioRxiv - Molecular Biology 2021Quote: small interference RNA (siRNA)-mediated knockdown was achieved by transfection using HiPerFect (Qiagen, Venlo, The Netherlands), used according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: HeLa cells were transfected with 40 nM specific human RBM10-siRNA5 or control AllStar siRNA (Qiagen) using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... total RNA was isolated from siRNA-treated cells using an RNeasy Mini Kit (QIAGEN, Venlo, Nederland) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Total RNA was isolated from siRNA-treated cells using the RNeasy mini kit (Qiagen, Hilden, Germany) or the Quick-RNA kit (Zymo Research) ...
-
bioRxiv - Molecular Biology 2020Quote: ... siRNAs were then transfected into 2,000 A549 cells in each well using 0.5 μl HiPerFect (Qiagen) in a total volume of 50 μl and a final concentration of 20 nM siRNA ...
-
bioRxiv - Cancer Biology 2019Quote: ... 50 nM siRNA/well were used for transfection using 0.8 µl/well of Hi-Perfect (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... and for miR30 vectors 0.4 μg DGCR8 siRNA (Chang, Marran, Valentine, & Hannon, 2013b) (synthesized by Qiagen) in a total volume of 95.4 μl Opti-MEM (Gibco) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Transfection quality was monitored using a validated control (non-silencing) siRNA (1027281, Qiagen, Germantown, MD, USA). SW480 cells were transfected according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... For MdmX knockdown cells were transfected with FlexiTube siRNA Mdm4 (cat.#SI00037163, siMdmX#4) from QIAGEN or costume siRNA against MdmX (siMdmX#1 ...
-
bioRxiv - Developmental Biology 2024Quote: mESCs were plated on gelatin-coated plates in N2B27-2i and transfected with FlexiTube siRNAs (Qiagen) using DharmaFECT 1 (Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... The cells were then transfected with SHIP2 siRNAs (SI04371668, SI04360475, SI04267228, SI04207280) using Lipofectamine RNAiMAX (1027415, Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: Targeting siRNA was produced to interact with DNA sequences AAGCAATGAGCTGTTTGAAGA for CHC17 (Esk et al., 2010) (Qiagen), TCGGGCAAATGTGCCAAGCAA and AACTGGGAGGATCTAGTTAAA for CHC22 (1:1 mixture of siRNAs were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... against HNF1B or ERG were tested in knockdown efficiency and compared with the siRNA negative-control (Qiagen) by RT-qPCR ...
-
bioRxiv - Microbiology 2021Quote: Cells were transfected with a mix of DIDO1 siRNAs (FlexiTube™ GeneSolution GS11083 for DIDO1, 1027416, Qiagen) using HiPerFect transfection reagent (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339, human METTL3: QIAGEN SI05020414 and human DDX6 ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were reverse transfected with 25 nM of either All Stars Negative control siRNA (siCtrl; QIAGEN, #1027280), siGRHL2 #1 (RNA-seq and qPCR validation experiments ...
-
bioRxiv - Microbiology 2019Quote: Transfection with siRNAs was performed using HiPerFect transfection reagent according to the manufacture’s reverse transfection protocol (Qiagen). First ...
-
bioRxiv - Neuroscience 2019Quote: ... Astrocytes were transfected with 80 nM of Rho-1 siRNA from a 20uM stock (Qiagen, Germany #SI01401743) or 80 nM AllStars Negative Control Scrambled siRNA from a 20uM stock (Qiagen #SI03650318) ...
-
bioRxiv - Cancer Biology 2021Quote: EBC1 cells were transfected in suspension using pooled siRNA at 50 nM using the HiPerfect protocol (Qiagen) and immediately seeded for proliferation and lysis ...
-
bioRxiv - Cell Biology 2023Quote: ... RPE1 cells or HeLa FlpIn cells were transfected with siRNAs at 100 nM using the HiPerFect (Qiagen), according to manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: Pre-designed small interfering RNAs (siRNAs) and the non-target control (negative control) AllstarNeg were from Qiagen. 2×104 HeLa cells were reverse transfected with 10 nM siRNA using Lipofectamine RNAiMax (Life Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Negative control groups received non-silencing siRNA (Target sequence AAT TCT CCG AAC GTG TCA CGT) from Qiagen. The cells were incubated with the siRNA for 72 hours ...
-
bioRxiv - Microbiology 2019Quote: HeLa cells (2×106) were transfected with 100 pmol of validated siRNAs against all human ZDHHCs [42] (Qiagen) using interferrin transfection reagent (Polyplus) ...
-
bioRxiv - Cell Biology 2021Quote: ... AllStars negative control (SI03650318) and functionally-validated siRNAs against PHB (SI02223557) and PHB2 (SI02780918) were purchased from Qiagen; the siRNA against AURKA was synthesised and purchased from Eurogentec ...
-
bioRxiv - Cell Biology 2019Quote: Gene silencing in HEK293 cells was carried out via transient transfection of 10 nmol siRNA (NAV3_siRNA1: SI04272646, NAV3_siRNA2: SI04366215) or scrambled control (Qiagen) using Lipofectamine 3000 (ThermoFisher) ...
-
bioRxiv - Neuroscience 2021Quote: ... neurons were transfected at 3 DIV with siRNA targeting Kdm6a or ntRNA using Effectene Transfection Reagent (Qiagen, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... knockdown of KCNB1 expression in human cells was carried out using a mixture of 4 siRNA duplexes (Qiagen; Cat# ...
-
bioRxiv - Systems Biology 2020Quote: ... Cells were treated with a pool of four small siRNAs per gene with the following sequences (Qiagen 1027280):
-
bioRxiv - Cell Biology 2020Quote: RNA was collected from siRNA-treated HeLa cells and extracted using the RNeasy PowerLyzer Tissue & Cells Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... mRNA was extracted 24 hours after siRNA transfection using using the RNeasy mini kit (Qiagen, Valencia, CA, USA). 500ng of total RNA was reverse transcribed into cDNA using random hexamers and SuperScript IV reverse transcriptase according to manufacturer’s recommendation ...
-
bioRxiv - Cancer Biology 2022Quote: ... Knockdown of EN2 gene was conducted by introducing four different siRNA primers into the cells (Qiagen, Hilden, Germany) (Table 2) ...
-
bioRxiv - Systems Biology 2022Quote: ... siRNA was transfected into RWPE-1 cells in a 24-well plate using HiPerFect Transfection Reagent (Qiagen, 301704). siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Cell Biology 2023Quote: RT-qPCR for siRNA validation was performed by extraction of RNA using the RNeasy Mini kit (Qiagen 74104) according to the manufacturer’s recommendations 24hr post siRNA transfection ...
-
bioRxiv - Cell Biology 2023Quote: siRNA targeting human GPRC5A (siGPRC5A_4 against target sequence 5′-CTGGGTGTGTTGGGCATCTTT-3′, cat# SI04438021) and non-targeting control siRNA (cat# Ctrl_AllStars_1, target sequence not disclosed) were purchased from Qiagen. Human primary keratinocytes were transfected at 20 nM final siRNA concentration using Lipofectamin 2000 reagent (Life Technologies ...
-
bioRxiv - Microbiology 2024Quote: Cells were grown to 40% confluence and then incubated with 50 nM siRNA and Attractene transfection reagent (QIAGEN) for 36 h according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2020Quote: ... Cells were passaged and transfected every 72 hours with 12.5 nM SMPD1 ON-TARGETplus SMARTpool siRNA (Dharmacon) using HiPerfect transfection reagent (Qiagen) in the absence or presence of 10 μM CBE up to 10 days in culture ...
-
bioRxiv - Molecular Biology 2019Quote: Cells seeded in 24-well plates were transfected with siRNA against intended targets (Qiagen, sequences provided in Table S3) using Lipofectamine RNAiMAX (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: A549-ACE2 cells were treated with 30μM siRNA (SRPK1: Horizon M-003982-02-0010; Non-targeting: Thermo 4390843) following the HiPerfect (Qiagen) Fast-Forward protocol and plated in 6 well plates ...
-
bioRxiv - Immunology 2021Quote: ... The effects of mRNA silencing by siRNA was investigated by real-time PCR using specific QuantiTect primer Assay (Qiagen).