Labshake search
Citations for Qiagen :
451 - 500 of 3491 citations for Ethyl 5 1 3 dioxolan 2 yl 2 thiophenecarboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2024Quote: ... Cells were harvested 2 days later using RNEasy Plus Mini Kit (Qiagen, 74134) with QIAshredder (Qiagen ...
-
bioRxiv - Pathology 2024Quote: ... 2) TRIzol method versus TRIzol method plus RNeasy clean-up (QIAGEN, Hilden, Germany).
-
bioRxiv - Cancer Biology 2021Quote: ... total RNA from untreated or RSL3-treated (with or without 2 hr pre-treatment with 2 µM Ferrostatin-1) MM1S and MM1R cells was extracted using the RNeasy Mini Kit (Qiagen, Venlo, the Netherlands) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Cancer Biology 2024Quote: ... total RNA was extracted from 3 – 5 x 106 cells using Rneasy kit with Dnase I treatment (QIAGEN), following manufacture instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The DNA of the 20 Jan and 3 Mar 2021 samples (1/3 pellet) was extracted with the DNeasy UltraClean Microbial Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and run on the RT^2 First Strand Kit (Stem cell PCR array) (Qiagen). The array was run in triplicate (N=3 ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA (2 μg) was extracted from MPB with the RNeasy Mini Kit (Qiagen) and then reverse-transcribed using the First Strand cDNA Synthesis Kit (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... 2 mL of fermentor culture was added to 4 mL RNAprotect Bacteria Reagent (Qiagen) and immediately vortexed for 10 sec ...
-
bioRxiv - Molecular Biology 2021Quote: ... 300 mM of NaCl and 2 μL of RNase A (0.5 mg / mL) (Qiagen) were added to the collective eluates which were incubated at 65 °C overnight ...
-
bioRxiv - Biophysics 2021Quote: ... 2 g/ml Biotinylated Anti-His Antibody (Penta-His Biotin Conjugate; Qiagen; No. 34440) in T50 buffer was introduced into flow cells at 50 μl/min ...
-
bioRxiv - Neuroscience 2020Quote: ... and agitated at 30 HZ for twice 2 minutes in the TissueLyser II (Qiagen). RNA isolation was performed on the QIAsymphony (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were then treated with RNase A (2 mg/ml in water, Qiagen, 19101) for 2 hours at 37°C ...
-
bioRxiv - Biophysics 2021Quote: The supernatant was mixed with 2 mL Ni-NTA resin (Ni-NTA agarose; Qiagen) pre-equilibrated with buffer A200 (50 mM Tris pH 7.6 ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were lysed with 27G1/2 needles and then homogenized with QiAshredder columns (Qiagen). Total RNA from triplicate experiments were purified with the RNAeasy Plus Kit (Qiagen) ...
-
bioRxiv - Systems Biology 2020Quote: ... mechanically homogenized and further lysed in RLT buffer with 2-mercaptoethanol on TissueLyser (Qiagen) with 3 mm beads then extracted according to the protocol using RNeasy Mini Kit (Qiagen).
-
bioRxiv - Cell Biology 2021Quote: ... The cleared lysate was run through Ni+2-NTA agarose beads (Qiagen [QA], 30250) to allow binding of the histidine-tagged (recombinant ...
-
bioRxiv - Cell Biology 2021Quote: ... before adding it to 2 ml of Strep-Tactin superflow resin (Qiagen, Hilden, Germany) which was pre-equilibrated with 10 ml lysis buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... and homogenized for 2 cycles with a Bead Beater TissueLyser II (Qiagen, Germantown, MD) at 24 Hz for 3 min each ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 mM 2-mercaptoethanol) and the proteins eluted from nickel-NTA agarose beads (Qiagen; using buffer containing 25 mM Tris-HCl (pH 7.6) ...
-
bioRxiv - Microbiology 2022Quote: RNA was isolated from 2 x 106 cells using RNeasy plus mini Kit (Qiagen). Reverse transcription was performed with either random decamers or HIV antisense-specific primers ...
-
bioRxiv - Microbiology 2020Quote: ... Lung samples were homogenized with DMEM + 2% FBS in a TissueLyser (Qiagen Inc., CA) operated at 25-30 Hz for four minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cell lysate supernatant was passed through a Ni+2-NTA resin column (Qiagen), and protein was purified following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Feces samples were homogenized for 2 min at 25 Hz in a TissueLyzerII (Qiagen) using metal beads ...
-
bioRxiv - Cell Biology 2020Quote: ... CLEC-2-expressing or PDPN KO FRCs were transfected using Attractene Transfection Reagent (Qiagen) with one or both of the following plasmids ...
-
bioRxiv - Immunology 2021Quote: ... The product was run on a 2% gel and purified by gel extraction (Qiagen). Purified product was amplified using primers index3 and index6 ...
-
bioRxiv - Immunology 2021Quote: ... The product was run on a 2% gel and purified by gel extraction (Qiagen). Purified product was amplified using primers index3 and index4 ...
-
bioRxiv - Immunology 2021Quote: ... PCR products were run on 2% agarose gels and purified by gel extraction (Qiagen). Purified barcode and gene products were combined with linearized yeast-display vector (pDD003 digested with EcoRI and BamHI ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RNA was detected using One-step probe RT-qPCR kits (Qiagen) run on the CFX96 detection system (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RNA was detected using One-step probe RT-qPCR kits (Qiagen) run on the CFX96 detection system (Bio-Rad) ...
-
bioRxiv - Genetics 2020Quote: ... 2 µL of bisulfite-converted DNA were amplified with the HotStartTaq DNA Polymerase (QIAGEN) and primers containing internal barcodes using following conditions ...
-
bioRxiv - Pathology 2023Quote: ... with 2 x 3.2 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 30 r/s for 3 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... collected in DMEM with 2% serum and homogenized using a Tissue-Lyser II (QIAGEN). Samples were centrifuged at 8,000 rpm for 8 minutes and viral titers were quantified using a plaque assay as described above ...
-
bioRxiv - Neuroscience 2024Quote: ... Homogenization was performed with 2 tungsten beads using a Tissue Lyser (Qiagen, cat# 85300) run at 30 cycles/sec ...
-
bioRxiv - Developmental Biology 2023Quote: 2 μg of genomic DNA was bisulfite treated using the EpiTect Bisulfite Kit (Qiagen) and eluted in 20 μL of 1:10 of the supplied EB buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... The FLAG elution was transferred to 2 ml of NI-NTA agarose resin (Qiagen) and incubated for 1 hour ...
-
bioRxiv - Genomics 2024Quote: ... The product was purified from a 2% agarose gel (QIAquick Gel Extraction Kit, Qiagen). In parallel ...
-
bioRxiv - Molecular Biology 2024Quote: ... until saturated then immersed in 2 ml RNAprotect Cell Reagent or RNALater (Qiagen Corporation) or collected on GenTegra Ahlstrom GenSaverCards for Blood and Saliva (Gentegra Corporation) ...
-
bioRxiv - Genomics 2020Quote: ... 5 µL Proteinase-K (20 mg ml-1, Qiagen) was added to the solution and incubated at 60°C for 30 minutes ...
-
bioRxiv - Genomics 2021Quote: ... then 24 mL buffer PB (5:1, Qiagen #19066) and 1.2mL NaOAc were added sequentially ...
-
bioRxiv - Systems Biology 2022Quote: ... Ten millilitres of culture were pelleted by immediate centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Bioengineering 2024Quote: Ten millilitres of culture were pelleted by centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Cancer Biology 2021Quote: ... After 2 hours we extracted the total RNA (RNeasy mini kit, Qiagen, cat. n. 74104) from 40 animals for each of the 3 experimental replicates (total ...
-
bioRxiv - Cell Biology 2020Quote: RNA from 2×107 cells was isolated using the RNeasy Mini Kit (Qiagen, Venlo, Netherlands), cDNA was generated by reverse transcription on CFX96 real-time system (BioRad ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 2 μl sucrose purified virus using the RNeasy mini kit (QIAgen). The RNA was then treated with TURBO DNase (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by 2 minutes (40 oscillation per second) on a bead shaker (Qiagen Tissue lyser)-centrifuged at 1000g for 5 minutes at 4 °C to remove debris ...