Labshake search
Citations for Qiagen :
451 - 500 of 1598 citations for Estriol 2 4 16 17 D4 98% 95% Pure since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... tumefaciens culture was added to 2 ml RNAprotect Bacteria Reagent (Qiagen) and RNA was isolated using RNeasy columns (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... cleared lysates were incubated with 2 mL Ni-NTA agarose (Qiagen) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... cfDNA was extracted from approximately 4□ml of plasma (QIAamp Circulating Nucleic Acid kit, Qiagen) and then constructed into sequencing libraries with end repair ...
-
bioRxiv - Genomics 2020Quote: Testis tissue was homogenized at 4°C in 1ml QIAzol Lysis Reagent (Qiagen, Hilden, Germany) together with RNase-Free Zirconium Oxide Beads (NextAdvance ...
-
bioRxiv - Genomics 2019Quote: ... cfDNA was extracted from 1 or 4 ml of urine according to manufacturer recommendations (Qiagen Circulating Nucleic Acid Kit ...
-
bioRxiv - Biophysics 2020Quote: ... 4 °C) and the supernatant was then incubated with 200 µl Ni-NTA (#30230, Qiagen) beads for 1 hour at 4 °C ...
-
bioRxiv - Genetics 2019Quote: ... 4 μl of PCR products were subsequently added to 21 μl PyroMark Master Mix (Qiagen) containing 10 pmol of barcoded primers (adapted from NEXTflexTM 16S V1-V3 Amplicon Seq Kit ...
-
bioRxiv - Genomics 2020Quote: ... 4 μl of pooled products were subsequently added to 21 μl PyroMark Master Mix (Qiagen) containing 10 pmol of barcoded primers (adapted from NEXTflexTM 16S V1-V3 Amplicon Seq Kit ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 °C) and the supernatant was then loaded onto 1 ml HisTrap HP column (Qiagen) at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The soluble cell lysate fraction was loaded on a 4 mL Ni-NTA column (QIAGEN) pre-equilibrated with binding buffer ...
-
bioRxiv - Physiology 2021Quote: Total RNA was purified from embryos at 4 dpf using an RNeasy micro kit (Qiagen) with DNase I ...
-
bioRxiv - Neuroscience 2022Quote: ... we used 4 columns to purify product following the MinElute PCR Purification Kit manual (Qiagen). DNA from each column was eluate using 25 μL EB buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... Clarified lysate was then incubated for one hour at 4 °C with Ni-NTA (Qiagen) in batch adsorption format ...
-
bioRxiv - Bioengineering 2022Quote: ... 350 µL of NucleoSpin RNA extraction buffer along with 4-5 ceramic beads (Qiagen 13113) were added 14into the tube ...
-
bioRxiv - Molecular Biology 2020Quote: ... 30 cycles) and the 170bp band purified on a 4% agarose gel (Qiagen gel purification). Fragments were extended with homology arms (Table 1 ...
-
bioRxiv - Cell Biology 2019Quote: ... 4 µg of the total RNA was treated with a GeneRead rRNA Depletion kit (Qiagen) and then with an RNeasy MiniElute kit (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... the supernatant was incubated for 1 hour at 4°C with Ni-NTA-agarose (Qiagen), washed several times with lysis buffer and the protein was eluted by incubation for 3 hours with lysis buffer containing 500 mM imidazol ...
-
bioRxiv - Plant Biology 2022Quote: Total plants RNA were extracted from 4 weeks plants using the RNeasy kit (Qiagen, Germany) and two micrograms of RNA was reverse-transcribed using SuperScript IVTM Reverse Transcriptase according to the manufacturer’s instructions (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the supernatant was added to a gravity column containing 4 mL of Ni-NTA (Qiagen). Beads were washed with a high salt buffer (20 mM HEPES pH 7.5 ...
-
bioRxiv - Genomics 2022Quote: ... to which 4 μL of RNase A (100 mg/mL) was added (Qiagen, Germantown MD). The cell lysate was applied to a DNeasy Mini spin column ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were cleaned with the UltraClean 96 PCR Cleanup kit (Qiagen, Cat. #12596-4) and pooled using the same volume for each sample ...
-
bioRxiv - Genomics 2023Quote: ... Button valves were opened and biotinylated anti-pentaHis antibody (Qiagen, 1:4 dilution in HEPES) was flowed for 30 minutes ...
-
bioRxiv - Microbiology 2023Quote: Lungs from hamsters at 4 or 6 dpi were homogenized in PBS with TissueRuptor (Qiagen). A part of the whole lung homogenate was subjected to plaque assays for virus titration as described above ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluent was then incubated overnight at 4°C with Ni-NTA beads (Qiagen, 36111), which were subsequently collected ...
-
bioRxiv - Microbiology 2023Quote: ... or from whole fecal pellets using a DNeasy PowerSoil HTP 96 kit (Qiagen 12955-4). Library preparation and sequencing was performed at the NGS Competence Center NCCT (Tübingen ...
-
bioRxiv - Molecular Biology 2023Quote: ... An A base was added to the 3’ ends with Klenow (3’-4’ exo-) (Qiagen). The processed ds-cDNA was then ligated to Illumina sequencing adapters with T4 DNA Ligase (Qiagen) ...
-
bioRxiv - Immunology 2024Quote: ... organ parts collected as described above were homogenized by TissueLyser II (Qiagen, 25Hz, 4 min) and centrifuged to remove debris ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 μl of siRNAs were mixed with 37.5 μl of Hiperfect transfection reagent (301707, Qiagen) and enough Optimem Opti-MEM reduced serum medium (31985070 ...
-
bioRxiv - Immunology 2023Quote: ... The first round of PCR was carried out using the ImmunoSEQ proprietary PCR primer mix (32 μL per sample containing 25 uL of QIAGEN 2× Multiplex PCR Master Mix, 5μL of QIAGEN 5x Q-solution and 2 μL of primer mix). A positive control reaction ...
-
bioRxiv - Plant Biology 2020Quote: ... at 65°C overnight and treated with 2 μg RNase A (Qiagen) for 1h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Generation of cDNA was performed by GoTaq 2-step RT system (Qiagen). Real-time PCR reactions were measured by ABI StepOnePlus system using SYBR green qPCR master mix (ThermoFisher) ...
-
bioRxiv - Microbiology 2019Quote: The Microbial DNA qPCR Array Intestinal Infection 2 kit (Qiagen, Hilden, Germany) (Supplementary table 1 ...
-
bioRxiv - Immunology 2019Quote: ... pelleted and lysed in RLT Plus buffer supplemented with 2-mercaptoethanol (Qiagen). The RNeasy Plus Mini Kit (Qiagen ...