Labshake search
Citations for Qiagen :
451 - 500 of 1359 citations for Chocolate Agar with Bacitracin for Haemophilus isolation 15x100mm plate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... Isolation of total RNA was performed using the RNeasy Micro kit (Qiagen, Stokach, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolation of total RNA including miRNA was carried out using the miRNeasy (Qiagen) or the AllPrep DNA/RNA (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... and 24 hours post followed by RNA isolation using an RNeasy mini Kit (Qiagen) per the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA isolation was performed according to the manufacturer’s instructions using QIAamp DNAMiniKit (QIAGEN, Germany). Copy numbers of HSV-1 were measured using Virusys Corporation’s HSV-1 qPCR kit with a FAM/BHQ-labeled probe specific for glycoprotein D (gD ...
-
bioRxiv - Immunology 2021Quote: RNA was extracted from cecal tissue using a RNeasy isolation kit (Qiagen, Hilden, Germany). Genomic DNA was removed using a Turbo DNA-free kit (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by isolation of genomic DNA using the DNeasy Blood and Tissue kit (Qiagen) according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: ... Mock community isolates were extracted using the PowerSoil DNA Isolation kit (Qiagen, Hilden, Germany).
-
bioRxiv - Synthetic Biology 2021Quote: ... Isolation of genomic DNA (gDNA) was performed with the DNeasy Blood & Tissue Kit (Qiagen). The pCasPP plasmid was used as vector for the different experiments in this study.14 The plasmid itself is 9.7 kb in size ...
-
bioRxiv - Biophysics 2021Quote: ... coli bacteria and isolation from the cells using a QIAprep Spin Miniprep Kit (Qiagen), the plasmid was linearized by restriction enzyme digestion at the last restriction site RS6 ...
-
bioRxiv - Pathology 2021Quote: ... Viral RNA isolation was performed using a Qiagen RNeasy Plus Mini Kit (Qiagen; #74134), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genomic DNA isolation was performed using DNeasy Blood and Tissue DNA extraction kit (Qiagen) according to manufacturer’s recommendations ...
-
bioRxiv - Evolutionary Biology 2021Quote: All DNA was extracted using the Qiagen puregene kit A DNA isolation kits (Qiagen). For D ...
-
bioRxiv - Genetics 2021Quote: All genomic DNA isolation was completed using the DNAeasy blood and tissue kit (Qiagen) according to the manufacturers protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Ribosome-protected fragments were purified using miRNeasy RNA isolation kit (QIAGEN, cat. No. 217004). RNA was size selected ...
-
bioRxiv - Immunology 2020Quote: RNA isolation from FACS-sorted cells was performed using the miRNeasy mini kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... and lungs purified for total DNA using the DNeasy Isolation Kit (Qiagen, MD, USA). DNA concentration was assessed using a Nano Drop spectrophotometer and normalized to equal concentration for qPCR analysis (50ng/ul) ...
-
bioRxiv - Immunology 2020Quote: 10 million PBMCs were thawed and used for RNA isolation (Qiagen, RNeasy Mini Kit). Removal of any residual genomic DNA was performed using the Turbo DNA-Free kit (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were processed for DNA isolation from using the MoBio PowerMax soil kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Pathology 2022Quote: Total RNA was isolated using the RNeasy Mini RNA isolation kit (Qiagen, Valencia, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from biomass on filters using the PowerSoil DNA Isolation Kit (Qiagen) using the manufacturer’s protocol with the exception that diced filters were added to the bead tube in place of soil ...
-
bioRxiv - Neuroscience 2023Quote: ... or used for RNA isolation using the RNeasy Micro Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2022Quote: ... Fecal DNA was isolated using the Fast Stool Isolation Kit (Cat. No. 51604, Qiagen). As previously reported4316S rRNA V3 through V4 region was amplified using primers 319F (CTCCTACGGGAGGCAGCAGT ...
-
bioRxiv - Neuroscience 2022Quote: ... Total RNA isolation was performed using RNeasy Mini Kit and RNeasy Micro Kit (Qiagen) respectively ...
-
bioRxiv - Neuroscience 2024Quote: RNA isolation was carried out using the RNeasy Plus Micro Kit (Cat#74034, QIAGEN) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was extracted from pellets using the DNeasy PowerFood Microbial DNA Isolation Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Bacteria isolates then underwent DNA isolation using AllPrep Bacterial DNA/RNA/Protein Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA and DNA isolation was performed using the Qiagen All prep kit (Qiagen #80204) following the manufacturers protocol ...
-
bioRxiv - Physiology 2023Quote: DNA was extracted from single fecal pellets using the PowerSoil DNA isolation kit (QIAGEN) on the automated QIAcube platform using the inhibitory removal technology (IRT ...
-
bioRxiv - Cancer Biology 2024Quote: DNA isolation was performed using the Blood and Cell Culture DNA Mini Kit (QIAGEN). The isolated DNA samples were sent to the Center for Applied Genomics at the Children’s Hospital of Philadelphia for the SNP array analysis using the Infinium Global Screening Array-24 v3.0 Kit (Illumina) ...
-
bioRxiv - Cell Biology 2023Quote: ... Large-scale isolation of plasmid DNA was done using the QIAprep maxiprep kit (Qiagen) from 150 mL of overnight bacterial culture supplemented with appropriate antibiotics ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were collected at OD6000.35 for RNA isolation by using the RNeasy kit (Qiagen). PrimeScript™ RT Reagent Kit (TAKARA ...
-
bioRxiv - Bioengineering 2023Quote: ... and RNA was isolated from each condition using an RNA isolation kit (Qiagen, US) according to the manufacturer’s protocols (n = 4) ...
-
bioRxiv - Microbiology 2023Quote: ... Bacterial DNA was isolated using a Qiamp PowerFecal DNA Isolation Kit (Qiagen, Hilden, Germany). A negative control was inserted periodically in the workflow after blocks of 16 samples to test for methodological contamination during processing ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were collected for total RNAs isolation using RNeasy Plus Mini Kit (Qiagen, 74136). The same amount of total RNAs from each sample were reversely transcribed with PrimeScript RT Master Mix (TaKaRa ...
-
bioRxiv - Cell Biology 2023Quote: ... Large-scale isolation of plasmid DNA was done using the QIAprep maxiprep kit (Qiagen) from 150 mL of overnight bacterial culture supplemented with appropriate antibiotics ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The pellet was saved and isolation continued using the DNeasy Blood & Tissue Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2022Quote: Isolation of DNA was conducted using the Gentra Puregene Tissue Kit (4g) from Qiagen according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by proteinase K digestion and DNA isolation with QIAmp DNA Mini Kit (Qiagen), following the manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were transferred to spin columns from the RNeasy Isolation Kit (Qiagen, Hilden, Germany), and RNA was purified using the manufacturer’s instructions with elution in 30 µl RNase free water ...
-
bioRxiv - Cell Biology 2023Quote: ... Large-scale isolation of plasmid DNA was done using the QIAprep maxiprep kit (Qiagen) from 150 mL of overnight culture ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA was isolated from the samples using RNeasy Plant RNA Isolation Kit (Qiagen, Germany) with on-column DNA digestion using RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was extracted combining Trizol and Chloform isolations with RNAeasy micro kit columns (Qiagen). RNA concentration was determined using a Nanodrop ...
-
bioRxiv - Genetics 2023Quote: DNA isolation was performed using the DNeasy Blood & Tissue Kit (Qiagen, Cat. No. #69506) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... Total RNAs were isolated by TRIzol reagent and a bacterial RNA isolation Kit (Qiagen). DNase I treatment was done ...
-
bioRxiv - Cell Biology 2023Quote: Isolation of mRNA transcripts was performed using the RNeasy Kit (QIAGEN, Cat No. 74104) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Small-scale isolation of plasmid DNA was conducted using a QIAprep miniprep kit (QIAGEN) from 2 mL overnight bacterial culture supplemented with appropriate antibiotics ...
-
bioRxiv - Cell Biology 2024Quote: ... Large-scale isolation of plasmid DNA was conducted using the QIAprep maxiprep kit (QIAGEN) from 150 mL overnight bacterial culture supplemented with appropriate antibiotics ...
-
bioRxiv - Microbiology 2024Quote: DNA was extracted using the DNeasy PowerLyzer™PowerSoil DNA Isolation Kit (Qiagen, Germany) according to the manufacturer’s instructions and DNA concentration in extracts was measured with Qubit™ dsDNA High Sensitivity (HS ...
-
bioRxiv - Genomics 2024Quote: ... followed by total RNA (including miRNA) isolation using a commercial kit (Qiagen cat# 763134) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2024Quote: ... Then total RNA was isolated from the cells using an RNA isolation kit (Qiagen). 250 ng of RNA was reverse transcribed to cDNA using a high-capacity cDNA reverse transcriptase kit (Applied Biosystems ...