Labshake search
Citations for Qiagen :
451 - 500 of 1333 citations for Benzyl carbamic acid prop 2 ynyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... for 2×2min at 30Hz in a TissueLyser II (Qiagen). After homogenization ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Pellets were thawed in 2 mL RLT lysis buffer (Qiagen) containing 10 μL mL-1 of 2-mercaptoethanol ...
-
bioRxiv - Immunology 2023Quote: ... following a 2-step VDJ amplification using HotStarTaq Plus (Qiagen). PCR products were enzymatically cleaned again and illumina adapters and indexes were introduced via PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... equipped with a 48-sample holder (Tissue Lyser 2, Qiagen). The samples were treated with 1 ml pre-cooled (-20°C ...
-
bioRxiv - Genomics 2023Quote: ... using a TissueLyzer II (QIAGEN, 2min, 25 Hz, 2 times). The samples were incubated at room temperature for 5min ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RNU6-2 (Hs_RNU6-2_11 miScript Primer Assay, Qiagen, MS00033740) as housekeeping miRNA.
-
bioRxiv - Neuroscience 2023Quote: ... 2 μL of HiPerfect transfection reagent (cat. no. 301705, Qiagen) were mixed with 100 μL NeuroBasal medium without supplements ...
-
bioRxiv - Microbiology 2023Quote: ... fitted with a 2 ml tube holder (Qiagen, Germantown, MD). RNA was purified with the ZymoBIOMICS RNA Miniprep kit (R2001 ...
-
bioRxiv - Microbiology 2022Quote: ... loaded with 1-2 ml Ni-NTA agarose resin (Qiagen) pre-equilibrated with binding buffer ...
-
bioRxiv - Genomics 2022Quote: ... and ‘Sy-2’ plants using Genomic Tip (Qiagen, Hilden, Germany), and high-molecular-weight DNA (fragment length > 40 kb ...
-
bioRxiv - Neuroscience 2022Quote: ... and IRS solution (Qiagen Cat No./ID: 26000-50-2) for a custom protocol ...
-
bioRxiv - Immunology 2024Quote: ... 2 million PBMC were lysed using QIAzol Lysis Reagent (Qiagen). Samples were stored at -80°C until RNA extraction ...
-
bioRxiv - Neuroscience 2021Quote: ... Hsa-miR-124-3p Locked Nucleic Acid (LNA) power inhibitor and has-miR-124- 3p miRCURY LNA miRNA mimic (Qiagen, Germantown, MD) were resuspended with RNase-free water to 100 μM ...
-
bioRxiv - Biochemistry 2020Quote: ... A final 370,000 x g centrifugation at 4°C for 45 min yielded a myosin-containing supernatant that was loaded onto a 1 mL nickel-nitrilotriacetic acid agarose (Ni-NTA) (Qiagen, Cat# 30210) column equilibrated with column buffer (50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Systems Biology 2021Quote: Approximately 10 mL of amniotic fluid from each animal was used for cell-free RNA extraction with the QIAamp Circulating Nucleic Acid Kit (QIAGEN, Valencia, CA). RNA from the lung and hippocampus was extracted with the RNeasy Universal Mini Kit (QIAGEN ...
-
Cell-free DNA as a biomarker for prostate cancer: elevated concentration and decreased fragment sizebioRxiv - Cancer Biology 2020Quote: ... DNA was extracted from 7 to 55 mL of plasma using the Qiagen QIAamp Circulating Nucleic Acid Kit (Qiagen, Redwood City, CA), and double eluted with 40 μL of Qiagen Elution Buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... at 4°C and the supernatant was loaded onto a 1 ml nickel nitrilotriacetic acid-agarose column (Ni-NTA, Qiagen, Hilden, Germany) previously equilibrated with the corresponding lysis buffer ...
-
bioRxiv - Cell Biology 2020Quote: RNA FISH was performed using a FITC-labeled DNA oligo probe complementary to alpha satellite (Integrated DNA Technologies, Newark, NJ) or a biotinylated locked nucleic acid (LNA) oligo probe complementary to HSATII (QIAGEN, Hilden, Germany) (see Key Resources Table) ...
-
bioRxiv - Molecular Biology 2022Quote: ... hirae V-ATPase was expressed recombinantly in Escherichia coli and purified by affinity purification with a Ni+-NTA (nitrilotriacetic acid) column (Ni+-NTA Superflow; Qiagen, Hilden, Germany). The column was preconditioned with buffer consisting of 50 mM potassium phosphate ...
-
bioRxiv - Bioengineering 2024Quote: ... the extraction of total nucleic acid from transfected MOLT-4 cells (small scale, as described) was performed using a DNeasy Blood and Tissue Kit (QIAgen catalog # 69504) which includes direct lysis with proteinase K treatment ...
-
bioRxiv - Microbiology 2023Quote: The amino acid sequences of coronavirus spike orthologues were subjected to multiple alignment using CLC Workbench 7 (CLC Bio, Qiagen, Aarhus, Denmark). Protein sequence NCBI reference sequences for the indicated viruses are as follows ...
-
bioRxiv - Microbiology 2024Quote: ... The clarified lysate was transferred into the glovebox and loaded onto a gravity column in with 1 mL nickel-nitrilotriacetic acid resin (Qiagen, Hilden, Germany) that was preequilibrated with wash buffer (50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Microbiology 2024Quote: Total nucleic acid (DNA and RNA) was extracted from BDB by PowerSoil DNA Isolation Kit or PowerSoil Total RNA Isolation Kit (Qiagen, Hilden, Germany). qPCR was carried out for viral and protozoan pathogens including enterovirus ...
-
bioRxiv - Biophysics 2024Quote: ... The clarified lysate was then applied to a 10 mL bed volume Nickel nitrilotriacetic acid (Ni-NTA) agarose (Qiagen, cat. no. 30230) column ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA from MCF7 cells was isolated by proteinase K digestion at 65°C for 30 minutes followed by purification using the QIAamp circulating nucleic acid kit (Qiagen, Venlo, The Netherlands). Genomic DNA from frozen tissue sections of colorectal liver metastases was isolated using the NucleoSpin Tissue kit according to the manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA was then purified using a nucleic acid binding column with on-column DNase treatment (RNase-free DNase set, QIAGEN, Germantown, MD, USA). RNA was then eluted from the column in elution buffer.
-
bioRxiv - Genomics 2022Quote: ... Nucleic acids were extracted at CNM using either QIAamp MinElute Virus Spin (DNA) or QIAamp Viral RNA Mini kits (Qiagen, Germantown, MD, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: Pathway analysis was performed to integrate the targeted amino acid results using the Ingenuity Pathway Analysis Software (IPA) version 70750971 (QIAGEN, Redwood City, USA). Metabolites strongly correlated with tumor weight were identified using Spearman’s rank correlation analysis ...
-
bioRxiv - Bioengineering 2024Quote: ... The clarified supernatant was loaded onto a pre-equilibrated gravity flow column of nickel-nitrilotriacetic acid (Ni-NTA) beads (Qiagen, Germantown, MD, USA). The column was washed with the increasing concentration of imidazole and the recombinant nanobody protein was eluted at a gradient of 250-500 mM imidazole concentration in elution buffer (50 mM Sodium Phosphate ...
-
bioRxiv - Microbiology 2024Quote: ... 140µl of the sample suspension was used to extract total viral nucleic acid using the QIACube QIAamp viral RNA mini kit (Qiagen, Valencia, CA, USA) using the QIACube extraction instrument (Qiagen ...
-
bioRxiv - Biophysics 2024Quote: ... for 30 min at 4 °C before being applied to a 10mL bed volume Nickel nitrilotriacetic acid (Ni-NTA) agarose (Qiagen, cat. no. 30230) column ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... root or shoot tissues were ground in 2 mL tubes (Qiagen) containing 3 chrome steel beads of 3.2 mm diameter (BioSpec Products ...