Labshake search
Citations for Qiagen :
451 - 500 of 779 citations for 8 Benzylthio 6 oxo octanoic Acid Methyl Ester d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... 0.5% deoxycholic acid with a protease inhibitor) and pre-cooled tissue homogenizer (TissueLyser LT, Qiagen GmbH, Hilden, Germany) for 2-4 min at 45 Hz ...
-
bioRxiv - Cell Biology 2021Quote: RNA was extracted from up to 500 μl of plasma using QIA amp Circulating Nucleic Acid Kit (Qiagen) and eluted in 15 μl volume ...
-
bioRxiv - Genomics 2021Quote: ... cfDNA was isolated from 2 ml of plasma using either the manual QIAamp circulating nucleic acid kit (Qiagen), or the semi-automated QIAsymphony DSP Circulating DNA Kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: Total nucleic acids were extracted from half of each sample’s O.2μm filter using DNAeasy PowerSoil Kit (Qiagen). Extraction blanks were run with each round of DNA extractions and all returned no detectable nucleic acids using the maximum amount of blank sample (20μL ...
-
bioRxiv - Neuroscience 2023Quote: ... Deoayribonucleic acid (DNA) was extracted from stored buffy coat using the Blood Mini DNA kit (Qiagen, Valencia, CA). A TaqMan® single nucleotide polymorphism (SNP ...
-
bioRxiv - Microbiology 2023Quote: ... Viral nucleic acids were extracted using the QIAMP® Viral RNA mini kit (60 µL, Qiagen, Venlo, Netherlands) without the addition of carrier RNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 700 μl of the supernatant was mixed with 30 μl of nickelnitrilotriacetic acid-agarose (Ni-NTA, Qiagen) for 2 h at RT with mild rotation ...
-
bioRxiv - Cell Biology 2022Quote: ... and the soluble fraction of the lysate was incubated with Ni2+-nitrilotriacetic acid (NTA) beads (Qiagen, Hilden, Germany). Proteins were eluted with 300 mM imidazole in 60 mM NaH2PO4 ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was filtered through a 0.45 μm filter and loaded on a nickel-nitrilotriacetic acid column (Qiagen) pre-equilibrated with lysis buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysates of His-tagged talin constructs were purified by Ni-NTA-sepharose affinity chromatography (Ni2+-nitrilotriacetic acid, Qiagen), followed by a gel filtration column (Superdex 200 ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysates of His-tagged vinculin constructs were purified by Ni-NTA-sepharose affinity chromatography (Ni2+-nitrilotriacetic acid, Qiagen), followed by a Q-Sepharose ion exchange column ...
-
bioRxiv - Plant Biology 2024Quote: ... TAW1 and its homologues with their annotation IDs are listed in Supplementary Table 1. Amino acid sequences were aligned using CLC Workbench (v. 24.0.1) (Qiagen). Unrooted phylogenetic trees were generated by the neighbour-joining method with 1000 bootstrap replicates in CLC Workbench.
-
bioRxiv - Microbiology 2021Quote: Confluent 6-well plates of BAC16-iSLK.RTA cells were lysed using a DNeasy Blood and Tissue Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNAs were isolated from 6-month H19ΔICR/H19ΔICR and H19+/H19+ littermates (2 per genotype) using RNeasy Plus Mini Kit (Qiagen). Samples with RNA Integrity numbers >9 were Ribosomal RNA depleted using RiboZero Gold Kit (Illumina) ...
-
bioRxiv - Genomics 2020Quote: ... We extracted genomic DNA from the above 6 stocks individually by using DNeasy blood and tissue kit (Qiagen), and measured the purity and concentration of the resulting DNA with NanoDrop ND-1000 spectrophotometer (Thermofisher) ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA was collected from a single 6 cm dish using the DNEasy Blood & Tissue kit (69504, Qiagen). For both reps of day 0 ...
-
bioRxiv - Systems Biology 2020Quote: Three milliliters of cells from mid-log phase cultures were mixed with 6 mL RNAprotect Bacteria Reagent (Qiagen). Samples were mixed immediately by vortexing for 5 s ...
-
bioRxiv - Neuroscience 2021Quote: ... We pooled 2-3 fishes (6 weeks old) and extracted whole RNA using the RNAEasy Micro kit (Qiagen), with blood ...
-
bioRxiv - Microbiology 2021Quote: ... IL-6 and β-actin cDNA were determined by QuantiFast SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) at the conditions ...
-
bioRxiv - Genetics 2022Quote: ... RNA was extracted from cells grown in 6-well plates using RNeasy Mini Kit (Qiagen, Germantown, MD, USA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... for 30 minutes at 37°C followed by beadbeating with 50μg 0.1mm zirconium beads for 6 minutes on the Tissuelyzer II (Qiagen) prior to loading onto the Qiacube HT ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were transiently transfected in 6 cm Ø dishes using Effectene Transfection Reagent according to manufacturer’s instructions (Qiagen) two days before the measurement ...
-
bioRxiv - Microbiology 2023Quote: ... and up to 6 ml of culture per isolate per medium was harvested using Bacterial RNAprotect (Qiagen 76506). Three biological replicates were generated for each condition.
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted from frozen Hepa 1-6 cell pellets using the RNeasy Mini kit (74106, QIAGEN) following the manufacturer’s instructions with an on-column DNase digestion step (79254 ...
-
bioRxiv - Physiology 2024Quote: ... The apical portion was homogenized in tissue lysis buffer (Supplement Table 6.) using a bead mill (Qiagen, TissueLyserII). Homogenates were sonicated ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA was extracted from infiltrated patches of 16C leaves at 6 dpi using TRIzol® Reagent (Qiagen). RNA concentration and RNA purity were measured using Nanodrop (ND-1000 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Total RNA from 20 pooled embryos were collected at 6 dpf using TRIzol and RNeasy spin columns (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: mRNA analyses were performed by extracting total mRNA from HEPA1-6 cells using RNeasy mini kit (Qiagen, 74104) following manufacturer instructions ...
-
bioRxiv - Molecular Biology 2024Quote: RNA from human cell cultures was extracted from 6 well plates using RNeasy Plus micro kit (Qiagen, 74034). The plates were washed once with PBS ...
-
bioRxiv - Immunology 2024Quote: ... Libraries were rendered using the barcoded primers Ad1_noMX as forward and Ad2.1-6 as reverse and purified using a PCR cleanup kit (Qiagen), yielding a final concentration of about 30 nM in 20 μL ...
-
bioRxiv - Molecular Biology 2024Quote: ... NusA–Strep tag–gene 60–6 × HIS proteins were purified by sequential chromatography on Ni-NTA agarose (Qiagen) and S-protein agarose (Novagen) ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was extracted and 5 μg reverse transcribed from paired isolated Jz and Lz placental tissues (n = 8-10 per genotype/sex, across 11 litters) using the RNeasy Plus Mini Kit (Qiagen, DE) and the High-Capacity cDNA Reverse Transcription Kit minus RT inhibitor (Applied Biosystems ...
-
bioRxiv - Genetics 2021Quote: DNA was isolated from each of the 8 samples of flies using an adaptation of the Gentra Puregene Cell Kit protocol (Qiagen, 158767). Briefly ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was extracted from 32D-Cas9 cell lines expressing sgRNAs targeting Cbl introns 7 and 8 using an RNeasy Mini Kit (QIAGEN, 74106). cDNA was prepared using a QuantiTect Reverse Transcription Kit (QIAGEN ...
-
bioRxiv - Neuroscience 2020Quote: DNA and RNA from 8-10 mice was isolated and purified with AllPrep-DNA/RNA/miRNA-universal kit (Qiagen, Montreal, QC) and concentrations were determined by fluorometry on the Qubit system (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: At DIV 28-30 iPSC-MG from 8 C9orf72 ALS/FTD patient lines and 4 control lines were pelleted and lysed using QIAshredder (QIAGEN-79654) and RNA was isolated with RNeasy Mini Kit (QIAGEN-74104 ...
-
bioRxiv - Molecular Biology 2020Quote: ... pH 8) and the supernatant was incubated with 80 μl pre-washed Ni-NTA coated Sepharose beads (Ni-NTA agarose, (Qiagen, Hilden) for 90 mins at 4°C on a rolling incubator ...
-
bioRxiv - Plant Biology 2022Quote: ... pods from 8-10 different plants were pooled and RNA was isolated using RNAeasy plant mini kit (Qiagen, Germantown, MD, USA). RNA libraries were prepared using standard Illumina protocols and RNA sequencing was performed using NovaSeq 6000 PE150 by Novogene co ...
-
bioRxiv - Neuroscience 2024Quote: ... Inclusion bodies were solubilized in 8 M guanidine hydrochloride (GdnHCl) and then PrP was captured using Ni-NTA Superflow beads (Qiagen #30410). Bead-bound PrP was refolded on-column using a 4 h gradient from 6 to 0 M GdnHCl and then eluted using a gradient from 0 to 500 mM imidazole ...
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... The digestion products were fractionated on an agarose gel and the 8 kb viral genome band was excised and purified using the QIAquick gel extraction kit (Qiagen, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: Total RNA was extracted from the Ent-Pir Cx collected from the right and left hemispheres of PSD-exposed (n= 8) or 5G-exposed mice (n=7) using RNeasy® Micro kit (QIAGEN). Quality of RNA was confirmed on Agilent TapeStation (RIN > 8) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 8–10 larvae per genotype were pooled and total RNA was isolated using the Qiagen RNeasy mini kit (Qiagen catalog # 74104) or Zymo Direct-zol RNA Microprep Kit (Zymo Research catalog # R2060) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Final libraries were resuspended in 10 µl of EB buffer (10 mM Tris-Cl, pH 8) from Qiagen (cat. no. 19086) and amplified using 2.5 µl of Universal PCR primer (NEBNext Multiplex Oligos for Illumina ...
-
bioRxiv - Cell Biology 2024Quote: RNA at the defined stages of differentiation (day 0, 1, 5, 8, 11, 14, 17, 27, 35, 50) was extracted using RNeasy Plus mini kit (Qiagen, 74136) according to the manufacturer’s guidelines ...
-
bioRxiv - Biophysics 2021Quote: cfDNA was isolated from 2 mL of plasma for each sample via the QIAamp Circulating Nucleic Acid kit (Qiagen). ddPCR was performed using the QX200 Droplet Digital PCR System (Bio-Rad) ...
-
bioRxiv - Neuroscience 2021Quote: ... Hybridization was performed with a double DIG-labeled locked nucleic acid (LNA) probe for Nato3 (/5DiGN/ACTCAGCGTCTATCTCACCGA/3DiG_N/) (Qiagen) and incubated overnight at 62 °C ...
-
bioRxiv - Microbiology 2020Quote: ... followed by extraction of viral nucleic acids using a commercial kit (QIAamp MinElute virus spin kit, Qiagen, Venlo, Netherlands). A portion (2.5 µl ...
-
bioRxiv - Neuroscience 2020Quote: ESR1 expression was manipulated with custom-designed locked nucleic acid (LNA™) 15-mer antisense oligonucleotides designed by Qiagen following Kelly & Goodson.41 The antisense oligo for ESR1 knockdown (ESR1-KD ...
-
bioRxiv - Plant Biology 2020Quote: ... 200 mg of freeze-dried and ground roots were mixed with 1.6 mL of 1 M perchloric acid and homogenized in a TissueLyser II (Qiagen) in microtubes containing 6 glass beads of 2.8 mm in diameter ...