Labshake search
Citations for Qiagen :
451 - 500 of 2830 citations for 7 Oxabicyclo 2.2.1 heptan 2 ol 4 methyl 1 1 methylethyl 1R 2S 4R rel 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Total DNA (including integrated HIV-1 DNA and episomal HIV-1 DNA) was extracted using the QIAmp blood DNA minikit (Qiagen, Courtaboeuf, France) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... washed with 1 ml RNAprotect® Cell Reagent (Qiagen) and centrifuged for 10 min at 2,500 x g ...
-
bioRxiv - Genomics 2020Quote: ... 5 µL Proteinase-K (20 mg ml-1, Qiagen) was added to the solution and incubated at 60°C for 30 minutes ...
-
bioRxiv - Genetics 2019Quote: ... and mouse anti-Strep (Qiagen Cat# 34850, 1:500) with goat or donkey secondary antibodies from Jackson ImmunoResearch used 1:500 ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 µl zymolyase and 1 mg/ul RNase (QIAGEN). This was incubated in a 37 °C shaker for 1 hour before the addition of Proteinase K (10 µl ...
-
bioRxiv - Physiology 2021Quote: 1 μg purified extracted RNA (RNeasy Mini Kit, Qiagen) was reverse transcribed using qScript Reverse Transcriptase (Quanta Biosciences ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μL of proteinase K (20 mg/mL, Qiagen) was added and samples were incubated at RT for 10 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... mAb anti-His6 (34650; IF: 1/500) from Qiagen, mAb anti-GAPDH (GTX28245 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse antibodies against the His-tag (1:1000, Qiagen), rabbit antibodies against the C-terminal region of the collagen VI α1 chain (1:1000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Reaction conditions were 1 × HotStar® Taq buffer (Qiagen) supplemented with 1.6 mM MgCl2 ...
-
bioRxiv - Microbiology 2019Quote: ... resuspended in 1 mL RTL buffer (Qiagen RNeasy Kit) and lysed by bead beating (2 × 1 min ...
-
bioRxiv - Neuroscience 2021Quote: ... and diluted 1:50 in TE-Buffer (Qiagen, #1018499) to a final concentration of 1.75e12 vg/ml (kindly donated by I ...
-
bioRxiv - Immunology 2021Quote: 1-3 × 105 PBMCs were lysed in QIAzol (Qiagen). Full-length cDNA was then synthesized using the SMARTer technology (Takara Bio) ...
-
bioRxiv - Immunology 2020Quote: ... HIV-1 RNA was isolated using the QIAcube (Qiagen) from mouse plasma using the QIAamp MinElute Virus Spin Kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... 1:1,000 dilution of α-His-HRP antiserum (Qiagen), or 1:1,000 dilution of α-OmpA antiserum (Antibody Research Corporation ...
-
bioRxiv - Genomics 2021Quote: ... then 24 mL buffer PB (5:1, Qiagen #19066) and 1.2mL NaOAc were added sequentially ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 U HotStar Taq (Qiagen; based on polymerization activity), and 32 U FEN1 (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... After adding 1 ml of buffer PB (QIAGEN recipe), the samples were purified using QIAquick spin columns (QIAGEN ...
-
bioRxiv - Microbiology 2023Quote: ... combined with 1:10 (v/v) proteinase K (Qiagen) treatment ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1 mL of Qiazol lysis reagent (Qiagen, #79306) and homogenized for 2 x 3 minutes ...
-
bioRxiv - Genomics 2024Quote: ... whilst immersed in 1 mL QIAzol Lysis Reagent (QIAGEN). The resulting lysate was then made up to 3 mL with QIAzol Lysis Reagent and mixed thoroughly before 1 mL lysate aliquots were processed using RNeasy Lipid Tissue Kit 74804 (QIAGEN ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA (1 μg) was treated with DNaseI (Qiagen). cDNA was generated using M-MLV Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Microbiology 2024Quote: ... treated with 1 mL of RNAprotect Bacteria Reagent (Qiagen), and pellets were stored at −80°C until RNA isolation ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mL of Ni-NTA agarose resin (Qiagen, Germany) is packed onto a propylene chromatography/cartridge column (Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... using a MagAttract PowerMicrobiome DNA/RNA Kit (27500-4 EP/27500-4 EP-BP, Qiagen, Hilden, Germany). Amplicon library preparation and sequencing were done as described previously [35] ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from the gut samples (7-10 guts/sample) using the RNeasy Mini kit (Qiagen) and the on-column DNase I treatment (79254 ...
-
bioRxiv - Biochemistry 2021Quote: ... supernatant was harvested after 7 days of expression and incubated with 300 μL of Ni-NTA resin (Qiagen) at 4°C overnight ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was extracted from seedlings 7 dpg using the RNeasy Plant RNA Extraction kit (Qiagen Ltd., Surrey, UK). RT-PCR was performed using the OneStep RT-PCR kit (Qiagen ...
-
bioRxiv - Bioengineering 2022Quote: Tissue samples at day 0 and 7 were collected from devices and dissociated in the lysis buffer (Qiagen) by agitating with an electronic pestle for 1 min ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from CTLs (days 0, 5 and 7) using the RNeasy Plus Mini Kit (Qiagen. #74136), reverse transcribed to first-strand cDNAs using iScript™ cDNA Synthesis Kit (Bio-Rad ...
-
Promoter-adjacent DNA hypermethylation can downmodulate gene expression: TBX15 in the muscle lineagebioRxiv - Molecular Biology 2022Quote: ... Transfection into C2C12 or MCF-7 cells utilized a lipid-based reagent (Fast-forward protocol, Effectene reagent, Qiagen). As a reference for transfection efficiency ...
-
bioRxiv - Plant Biology 2023Quote: ... The grinding was done using 7 mm stainless steel beads with TissueLyser II bead mill (Qiagen, Hilden, Germany), 2 minutes totally at 25 Hz ...
-
bioRxiv - Immunology 2023Quote: ... cytometry-sorted 7-AAD- CD45+CD11b+F4/80+ cells were lysed in 350µL RLT lysis buffer (Qiagen, 79216). At 4 days post injury ...
-
bioRxiv - Developmental Biology 2020Quote: ... rhesus fibroblast cell line (n=1), pri-CTB (n=1, rh090419) and TSCs (n=3 rh121118, rh052318, cy091318) using a FlexiGene DNA Kit (Qiagen, cat no: 51206) and quantified using a Nanodrop™ One Microvolume UV-Vis Spectrophotometer (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Resuspend the cells in 10 ml of suspension buffer (10 mM EDTA pH8.0, 150 mM NaCl, 1% glycerol, Lysis blue (1×, from QIAGEN Plasmid Plus Midi Kit), RNase A (0.55 mg/ml) ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: 4 μL of Vapor-Lock (QIAGEN, 981611) was manually dispensed into each well of a 384-well plate using a 12-channel pipette ...
-
bioRxiv - Molecular Biology 2019Quote: ... with 4 µg RNAseA/ml (Qiagen 158922)] and placing cells on ice for 20 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 4 µg of RNaseA (Qiagen 28306) overnight as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... into 1 ml of RNA Protect solution (Qiagen, Hilden, Germany)
-
bioRxiv - Biochemistry 2022Quote: ... and incubated with 1 ml of Ni-Sepharose beads (Qiagen) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Genomics 2019Quote: Each sample was lysed with 1 ml of QIAzol (QIAGEN). Total RNA was extracted using the miRNeasy system and protocol (QIAGEN) ...
-
bioRxiv - Systems Biology 2020Quote: ... cells were resuspended in 1 ml buffer RLT from Qiagen RNeasy kit ...
-
bioRxiv - Genetics 2019Quote: ... Columns were washed twice with 1 mL PE Buffer (Qiagen) then transferred to a micro-centrifuge and dried by spinning 1 minute at 16,100 × g ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and 1 μL of 100 mg/mL RNAse A (Qiagen). The samples were incubated for 30 min at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... Supernatants were digested in 1 mg/ml Proteinase K (Qiagen) for 12 h at 55 °C then boiled for 10 min to inactivate the enzyme ...