Labshake search
Citations for Qiagen :
451 - 500 of 3900 citations for 4 Methoxy 2 2 3 4 5 5 Hexacb 13C12 99% 50 Ug Ml In Toluene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 5 nM siKDM4B (Qiagen, SI00449764), 5 nM siKDM4C (Qiagen ...
-
bioRxiv - Genetics 2021Quote: ... 5 mM Multiplex-Kit (Qiagen) and HPLC water to a total volume of 10 μL per sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 uL EB buffer (QIAGEN) was added to each well and mixed ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 μl RLT (79216, Qiagen) was added ...
-
bioRxiv - Molecular Biology 2022Quote: ... The supernatant was loaded onto a 10 mL Ni-NTA Superflow cartridge (connected two 5 mL cartridges) (30761, Qiagen). The cartridge was washed with 100 mL R buffer containing 200 mM NaCl ...
-
bioRxiv - Microbiology 2019Quote: ... using a MagAttract PowerMicrobiome DNA/RNA Kit (27500-4 EP/27500-4 EP-BP, Qiagen, Hilden, Germany). Amplicon library preparation and sequencing were done as described previously [35] ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 4 mL of culture using the miRNAeasy Mini Kit (Qiagen, Hilden, Germany) and Qiazol lysis reagent ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of 10 mg/mL RNase A (DNeasy Blood &Tissue kit, #69504, Qiagen, Hilden, Germany) was added to each sample and incubated at 37°C for 2 h ...
-
bioRxiv - Paleontology 2019Quote: Human 2 and 3: DNA was extracted from bones using QIAamp® DNA Investigator kit (56504, Qiagen). Bones were thoroughly washed (X5 ...
-
bioRxiv - Microbiology 2020Quote: ... and 6.25mL 2-mercaptoethanol (βME)) and homogenized at 30Hz for 3 min in a TissueLyzer II (Qiagen). 60 μL of 100% isopropanol was added to each tube and incubated for 1 min ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from pools of 2-3 organoids using RNeasy Plus Mini Kit (Qiagen, #74134) according to the manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA from approximately 25-50 EBs at day 5 of differentiation was isolated using RNeasy Mini kit (Qiagen) and quantified by NanoDrop (Thermo Fisher) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 50 μg/ml DNase (Qiagen) and 100 μg/ml heparin (Sigma) ...
-
bioRxiv - Cancer Biology 2021Quote: ... a cancer associated fibroblast (CAF) cell line (pCAF2) expressing TGF-β responsive SMAD2/3/4 RE-Luciferase (Qiagen, #CLS-017L) was created ...
-
bioRxiv - Immunology 2022Quote: ... Kidneys were mechanically disrupted with metal beads during 3 min at 4°C and DNA was then extracted using QIAmp DNA kit (Qiagen). Leptospiral DNA was specifically targeted using primers and probes designed in the lpxA gene (L ...
-
bioRxiv - Cancer Biology 2022Quote: 3 Type D and 3 Type V SCLC tumor-derived cell lines were treated with either vehicle (EtOH) or 4-OHT for 3 days and RNA was isolated using the RNeasy Mini Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... the eluted fraction was subsequently passed through a 5 ml Ni-NTA Superflow cartridge (Qiagen). The column was washed with 10 CV Ni-NTA Wash Buffer 1 (PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... Lysate was then batch bound to 5 mL of Ni-NTA Agarose (Qiagen, Cat# 30230) resin at 4°C for 1 hour in a beaker set on a stir plate ...
-
bioRxiv - Biochemistry 2021Quote: ... The protein solution was subsequently applied to a 5 ml Ni-NTA Superflow cartridge (Qiagen) which was washed with dialysis buffer supplemented with increasing concentrations of imidazole (10-250 mM) ...
-
bioRxiv - Microbiology 2019Quote: ... The supernatant was loaded onto gravity column containing 5 ml Ni-NTA affinity resin (Qiagen) pre-equilibrated and washed with 30 ml of Buffer A then eluted with Buffer A containing 300mM imidazole ...
-
bioRxiv - Microbiology 2020Quote: ... The clarified cell lysate was loaded onto a 5 mL Ni-NTA superflow cartridge (Qiagen), washed with buffer A ...
-
bioRxiv - Microbiology 2022Quote: ... The filtered lysate was then loaded onto a 5 ml Ni-NTA Superflow column (Qiagen), and the column was washed with buffer A containing 10 mM imidazole ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Supernatant was removed and incubated with 5 mL of pre-equilibrated Ni-NTA resin (Qiagen) for one hour at 4 °C with gentle shaking ...
-
bioRxiv - Biochemistry 2023Quote: ... the supernatant was loaded onto a 5 mL column of Ni-NTA agarose (Qiagen, Inc.) pre-equilibrated with buffer A ...
-
bioRxiv - Biochemistry 2023Quote: ... Lysate was then batch bound to 5 mL of Ni-NTA Agarose (Qiagen, Cat# 30230) resin at 4ºC for 2 hours in a beaker set on a stir plate ...
-
bioRxiv - Biochemistry 2023Quote: ... The cleared lysate was loaded onto two 5 mL Ni-NTA Superflow cartridges (QIAGEN, 30761) equilibrated with lysis buffer and washed with 10 column volumes of washing buffer containing 20 mM Tris pH 8.0 ...
-
bioRxiv - Systems Biology 2023Quote: Approximately 5 mg of frozen prefrontal cortex was homogenized in 1 ml RLT buffer (Qiagen) using a BeadBeater (BioSpec ...
-
bioRxiv - Neuroscience 2023Quote: ... Supernatants containing soluble proteins were applied to a 5 mL NiNTA-agarose gravity column (Qiagen) pre-equilibrated with lysis buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... The clarified lysate was then incubated with 5 mL of Ni-NTA agarose beads (Qiagen), pre-equilibrated in lysis buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... The filtered lysate was then passed over a 5 mL Ni-NTA Superflow column (Qiagen). Protein elution was carried out with a linear gradient of modified buffer B (20 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Biochemistry 2024Quote: ... The filtered lysate was then passed over a 5 mL Ni-NTA Superflow column (Qiagen). The column was washed extensively with buffer A and subsequently ...
-
bioRxiv - Biochemistry 2024Quote: ... The filtered lysate was then passed over a 5 mL Ni-NTA Superflow column (Qiagen). Protein elution was carried out with a gradient of buffer B ...
-
bioRxiv - Biochemistry 2024Quote: ... and 0.1% (v/v) β-mercaptoethanol was mixed with 5 mL Ni-NTA resin (Qiagen) for 1 h at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... the supernatant was loaded onto a 5-mL column of Ni-NTA agarose (Qiagen, Inc.) pre-equilibrated with buffer A ...
-
bioRxiv - Physiology 2022Quote: ... approximately 100 mg of adipose tissue and a 7 mm metal bead were placed in a 2 mL centrifuge tube containing 0.5 mL PBS buffer (pH 7.4) and homogenised in TissueLyser II (Qiagen) for 2 minutes at 25 Hz ...
-
bioRxiv - Cell Biology 2019Quote: ... accordingly to manufacturer’s instructions using non-targeting siRNA (siCtrl; 5’-AATTCTCCGAACGTGTCACGT-3’) and siRNA targeting Cav1 (SI00299635 and SI00299628) from Qiagen, or using pre-miR-NC (negative control ...
-
bioRxiv - Developmental Biology 2019Quote: ... The TSB (5’-ATTATTGCACCCAGTGCC-3’: the miR-92a-3p target site is underlined) was designed and produced by Qiagen, with an additional scrambled TSB to act as a negative control (5’-TAACACGTGTATACGCCCA-3’) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Total RNAs from batch of 3-5 embryos were extracted with the Rneasy® Micro Kit (Qiagen, Valencia CA). Relative quantitative PCR was performed on a QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Molecular Biology 2021Quote: ... 300 mM of NaCl and 2 μL of RNase A (0.5 mg / mL) (Qiagen) were added to the collective eluates which were incubated at 65 °C overnight ...
-
bioRxiv - Microbiology 2019Quote: ... the supernatant was applied to 2 mL of pre-washed Ni-NTA resin (Qiagen) at 4°C ...
-
bioRxiv - Biophysics 2021Quote: ... 2 g/ml Biotinylated Anti-His Antibody (Penta-His Biotin Conjugate; Qiagen; No. 34440) in T50 buffer was introduced into flow cells at 50 μl/min ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were then treated with RNase A (2 mg/ml in water, Qiagen, 19101) for 2 hours at 37°C ...
-
bioRxiv - Biophysics 2021Quote: The supernatant was mixed with 2 mL Ni-NTA resin (Ni-NTA agarose; Qiagen) pre-equilibrated with buffer A200 (50 mM Tris pH 7.6 ...
-
bioRxiv - Cell Biology 2021Quote: ... before adding it to 2 ml of Strep-Tactin superflow resin (Qiagen, Hilden, Germany) which was pre-equilibrated with 10 ml lysis buffer ...
-
bioRxiv - Systems Biology 2024Quote: ... Following a 2-hour RNase A treatment (Qiagen, 100 mg/ml, 1:1,000 dilution) at 37°C ...
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Immunology 2019Quote: ... mucosal scrapings and feces were homogenized in a 2 ml eppendorf containing 1 ml of DNA extraction buffer and a single 5 mm steel bead in a TissueLyzer (Qiagen) for 3 min at 30 Hz ...
-
bioRxiv - Microbiology 2022Quote: ... from the top A horizon were immediately collected for DNA extractions in 15 mL tubes containing 5 mL Lifeguard Soil Preservation Solution (QIAGEN) using chilled soil-processing trays ...