Labshake search
Citations for Qiagen :
451 - 500 of 2488 citations for 4 5 5 5 Tetrafluoro 4 trifluoromethoxy pentan 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Lysate was then batch bound to 5 mL of Ni-NTA Agarose (Qiagen, Cat# 30230) resin at 4°C for 1 hour in a beaker set on a stir plate ...
-
bioRxiv - Biochemistry 2021Quote: ... The protein solution was subsequently applied to a 5 ml Ni-NTA Superflow cartridge (Qiagen) which was washed with dialysis buffer supplemented with increasing concentrations of imidazole (10-250 mM) ...
-
bioRxiv - Microbiology 2020Quote: ... The clarified cell lysate was loaded onto a 5 mL Ni-NTA superflow cartridge (Qiagen), washed with buffer A ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS ...
-
bioRxiv - Biochemistry 2023Quote: ... the supernatant was loaded onto a 5 mL column of Ni-NTA agarose (Qiagen, Inc.) pre-equilibrated with buffer A ...
-
bioRxiv - Physiology 2023Quote: ... using a Qiagen TissueLyser LT bead mill and 5-mm stainless steel beads (Qiagen, #69989). RNA was isolated from the samples using the NucleoSpin RNA kit ...
-
bioRxiv - Biochemistry 2023Quote: ... Lysate was then batch bound to 5 mL of Ni-NTA Agarose (Qiagen, Cat# 30230) resin at 4ºC for 2 hours in a beaker set on a stir plate ...
-
bioRxiv - Pathology 2023Quote: Mouse tissues were homogenized with a 5 mm steel bead using a TissueLyser II (QIAGEN) for 5 min at frequency of 30 times/second ...
-
Sex-specific fear acquisition following early life stress is linked to amygdala glutamate metabolismbioRxiv - Animal Behavior and Cognition 2024Quote: ... which had been preprocessed with 5 mm metal balls in a TissueLyser (Qiagen, TissueLyser LT) for 1 minute at 25 Hz ...
-
bioRxiv - Developmental Biology 2024Quote: ... and RNA purified from 5-dpf embryos with the miRNeasy Mini Kit (Qiagen, catalog #: 217004). Using this cDNA library ...
-
bioRxiv - Neuroscience 2023Quote: ... Supernatants containing soluble proteins were applied to a 5 mL NiNTA-agarose gravity column (Qiagen) pre-equilibrated with lysis buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... The clarified lysate was then incubated with 5 mL of Ni-NTA agarose beads (Qiagen), pre-equilibrated in lysis buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... Cleared lysate was briefly incubated (approximately 5 min) with 3 ml Ni-NTA Agarose (QIAGEN) before flow-through was collected ...
-
bioRxiv - Microbiology 2022Quote: ... The filtered lysate was then loaded onto a 5 ml Ni-NTA Superflow column (Qiagen), and the column was washed with buffer A containing 10 mM imidazole ...
-
bioRxiv - Biophysics 2022Quote: ... Digested and 5’ dephosphorylated vector was purified using the QiaQuick PCR Cleanup kit (Qiagen, Germany). Both inserts and vector were eluted and stored in 10 mM Tris-Cl ...
-
bioRxiv - Cell Biology 2022Quote: ... 5-6 cryosections were also collected for RNA extraction using RNAeasy Micro kit (Qiagen, 74004). Quality of the RNAs was determined by Tapestation (Agilent ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was extracted from 5 million cells using RNeasy Plus Universal Kits (Qiagen, #73404) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... single-cells were sorted in 96-well plates containing 5 µL of TCL buffer (Qiagen) with 1% β-mercaptoethanol according to the gating strategy shown in Fig ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Supernatant was removed and incubated with 5 mL of pre-equilibrated Ni-NTA resin (Qiagen) for one hour at 4 °C with gentle shaking ...
-
bioRxiv - Biochemistry 2023Quote: ... The cleared lysate was loaded onto two 5 mL Ni-NTA Superflow cartridges (QIAGEN, 30761) equilibrated with lysis buffer and washed with 10 column volumes of washing buffer containing 20 mM Tris pH 8.0 ...
-
bioRxiv - Systems Biology 2023Quote: Approximately 5 mg of frozen prefrontal cortex was homogenized in 1 ml RLT buffer (Qiagen) using a BeadBeater (BioSpec ...
-
bioRxiv - Cell Biology 2024Quote: ... and transfer plasmids in a 45:5:50 ratio using PolyFect transfection reagent (Qiagen #301107) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... the supernatant was loaded onto a 5-mL column of Ni-NTA agarose (Qiagen, Inc.) pre-equilibrated with buffer A ...
-
bioRxiv - Biochemistry 2024Quote: ... The filtered lysate was then passed over a 5 mL Ni-NTA Superflow column (Qiagen). Protein elution was carried out with a gradient of buffer B ...
-
bioRxiv - Biochemistry 2024Quote: ... The filtered lysate was then passed over a 5 mL Ni-NTA Superflow column (Qiagen). Protein elution was carried out with a linear gradient of modified buffer B (20 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Biochemistry 2024Quote: ... The filtered lysate was then passed over a 5 mL Ni-NTA Superflow column (Qiagen). The column was washed extensively with buffer A and subsequently ...
-
bioRxiv - Biochemistry 2024Quote: ... and 0.1% (v/v) β-mercaptoethanol was mixed with 5 mL Ni-NTA resin (Qiagen) for 1 h at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... The resulting cDNA was diluted 1:5 by adding 10 uL of buffer EB (Qiagen) using a Mantis liquid handler ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 mL cultures were immediately added to centrifuge tubes containing 4 mL RNAprotect Bacteria Reagent (Qiagen), vortexed for 5 seconds and incubated at room temperature for 5 min ...
-
bioRxiv - Genomics 2021Quote: cfDNA was extracted from 2-4 mL of plasma using the QIAsymphony liquid handling robot (Qiagen). cfDNA concentration was determined using Qubit double-strand molecular probes kit (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... rotated at 4°C for 1.5-2 hr in 0.75 mL equilibrated Ni-NTA Agarose (Qiagen), followed by packing pre-equilibrated Poly-Prep Chromatography Columns (Bio-Rad) ...
-
bioRxiv - Immunology 2023Quote: DE genes between clusters 2 and 4 were fed to Ingenuity Pathway Analysis software from Qiagen. Enrichment pathways were sourced from Ingenuity core enrichment pathways.
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was extracted from about 2-4×106 cells using the RNeasy Mini Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... Supernatant was incubated for 2 h at 4°C while rotating with Glutathione superflow beads (Qiagen) for GST-tagged CMK-1 variants or nickel-nitrilotriacetic acid beads (Ni-NTA ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 PPKS/M and 4 PPKS/Y) using the AllPrep DNA/RNA Mini Kit (Qiagen). Indexed libraries were generates using the KAPA mRNA HyperPrep kit and sequenced on a NextSeq500 sequencer (NextSeq 500/550 High Output Kit v2.5 ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was isolated from 5-week-old Arabidopsis leaves with RNeasy Plant Mini Kit (74904; Qiagen) and used for subsequent RT-qPCR analysis ...
-
bioRxiv - Developmental Biology 2021Quote: ... were first frozen in liquid nitrogen and then homogenized with a 5 mm ∅ metal bead (Qiagen) for 2 min at 40 Hz using TissueLyser LT (Qiagen) ...
-
bioRxiv - Immunology 2021Quote: ... using stainless steel beads (5 mm mean diameter) and a TissueLyser LT adapter (Qiagen, Hilden, Germany) for 5 min at 50 Hz ...
-
bioRxiv - Immunology 2021Quote: ... the supernatant/Sepharose bead slurry was passed through a 5 ml polypropylene gravity flow column (Qiagen). The column was washed with 1 column volume of PBS before being eluted with 9 ml of Elution Buffer (0.1M Glycine/HCl buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... and resuspended in 10 mM Tris pH8 (500 μL) with 5 μL RNase A (Qiagen 19101) for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131 ...
-
bioRxiv - Microbiology 2021Quote: Reverse transcription was performed on 5 μl of RNA suspension using QuantiTect Reverse Transcription kit (Qiagen) with either the qiagen RT primer mix or the SgleadSARSCoV2-F primer (for negative strand viral transcripts ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated from adult (5-week-old) plants using an RNeasy plant kit (Qiagen), treated with a TURBO DNA-free kit (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was prepared from 5×106-1×107 cells using the RNeasy MIDI Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... AAVS1 +161 bp Reverse 5’ GAGGTTCTGGCAAGGAGAGA) and purified using the PCR clean up kit (Qiagen, MD). Amplicons were sequenced by MiSeq (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... was added to the tube together with a 5 mm stainless steel bead (Qiagen, Maryland, USA). The sample was homogenized for two minutes at 30 Hz using a TissueLyser II (Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: ... small RNA-enriched total RNA was treated twice with 5 μl of RNase-free DNase (Qiagen) for 45 minutes at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 5×106 human PBMCs from Cohort II using AllPrep RNEasy kits (Qiagen) and the small RNA-containing column flow-through collected ...
-
bioRxiv - Immunology 2020Quote: ... The bacterial lysates were mixed for 1 h with 5 ml of Ni-NTA resin (Qiagen) that had been equilibrated with buffer A ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 male C57Bl/6 mice-derived pial tissue was extracted using RNeasy Micro Kit (Qiagen, #74034). After RiboGreen quantification and quality control by Agilent BioAnalyzer ...
-
bioRxiv - Microbiology 2021Quote: ... sorokiniana were ground with two stainless steel beads (5 mm) using a TissueLyser (Qiagen, Hilden, Germany) at 30 Hz for 1 minute at room temperature and soaked in 1 ml of 100 mM sodium acetate buffer pH 5.0 at 70°C overnight ...