Labshake search
Citations for Qiagen :
451 - 500 of 3246 citations for 1 3 Bis S 1 naphthalen 1 yl ethyl 4 5 dihydro 1H imidazol 3 ium tetrafluoroborate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... Ni-NTA agarose beads (1 ml; Qiagen), washed and resuspended in loading buffer (50 mM Tris ...
-
bioRxiv - Immunology 2021Quote: ... 1-unit HotStarTaq Plus (QIAGEN, Cat#: 203607), 190 nM 3’ primer pool ...
-
bioRxiv - Cell Biology 2021Quote: Myosin-18A siRNA – #1 CACGAACTGGAGATGGATCTA (Qiagen SI04273668), #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Cell Biology 2021Quote: ... 25 nM of S1PR1 #1 (Qiagen, #SI00376201) 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... stored in 1 ml RNAlater (Qiagen, Netherlands), and moved to a −20 °C freezer for up to a month until RNA was extracted ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μM barcode LNA RT primer (Qiagen), 1U/μL RiboLock RNase inhibitor (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 uL ∼1.07 AU/mL Protease (Qiagen) was added to each well and incubated at 37 °C for 40 min ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 μL GlycoBlue coprecipitant (Qiagen; AM9515). RNA was precipitated after holding overnight at -80°C and centrifugation ...
-
bioRxiv - Genetics 2023Quote: ... 1 ul of 25 mM MgCl2 (Qiagen) and 1 ul of the primer mix (40 uM of the Forward primer ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... containing 1 × Master Mix (Qiagen Multiplex Kit), 0.4 μg/μL of BSA ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mL RNAProtect Bacterial Reagent (Qiagen, #76506) was added to each sample and thawed on wet ice for 10 min ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-RGS-His (Qiagen, 1:2000, 34610), anti-Myc (ChromoTek ...
-
bioRxiv - Biochemistry 2022Quote: ... Mouse anti-His (Qiagen, 34670; 1:200) and goat anti-mouse IgG-AF488 (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 1 μl Type-it Master Mix (Qiagen), 0.17 μM of either FAM or VIC ...
-
bioRxiv - Microbiology 2024Quote: ... and 1 μL GlycoBlue coprecipitant (Qiagen; AM9515). RNA was precipitated after holding overnight at -80°C and centrifugation ...
-
bioRxiv - Genomics 2024Quote: ... 2 µl Proteinase K (Qiagen, RP107B-1) and 5 µl water was added to each tube with 5 µl sub-library for a final volume of 20 µl per reaction ...
-
bioRxiv - Systems Biology 2024Quote: ... containing 1 mL of RNAProtect (Qiagen, 76506). The sorting rate was kept below 9000 events/s to minimize the false positive ratio and the flow rate was maintained at approximately 25-35 µL/min ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 0.5 mg ml-1 proteinase K (Qiagen), 0.2 mg ml-1 RNase A (Qiagen ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 0.2 mg ml-1 RNase A (Qiagen) were added and incubated at 50°C for 2 hours until the solution became uniform and clear ...
-
bioRxiv - Microbiology 2020Quote: ... Tissues were homogenized in 1 ml cell culture medium (see above) and a 5 mm steel bead in a TissueLyser (Qiagen, Hilden, Germany). Fecal samples were vortexed in sterile NaCl and the supernatant was sterile filtered (22µm ...
-
bioRxiv - Immunology 2020Quote: YFP+ Treg cells were sorted from spleen and LN of WT or Usp22fl/flFoxp3YFP-Cre mice (n=5 per group) and total RNA was isolated from 1×106 cells per sample using an RNeasy Mini Kit (Qiagen, Cat# 74104) as previously described47 ...
-
bioRxiv - Genetics 2020Quote: ... 30 mg of snap frozen tissues were processed adding 1 ml of QIAzol reagent in presence of one 5 mm stainless steel bead (Qiagen, Hilden, Germany). Total RNA isolation from homogenized tissues was performed using Qiagen RNeasy kit (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... we adapted the same conditions used in Dip-C40 and lysed each nucleus in 150 nL of lysis buffer containing 20 mM Tris pH8/20 mM NaCl/25 mM DTT/0.15% Triton X-100/1 mM EDTA/5 µg/mL Qiagen Protease (Qiagen, cat. no. 19157). After dispensing ...
-
bioRxiv - Molecular Biology 2022Quote: ... and isolated keratinocytes and fibroblasts from the skin and Wound7 (n = 5/each group) (Table 1 and Table S1) by using the miRNeasy Mini kit (Qiagen, Hilden, Germany) and prepared for library construction ...
-
bioRxiv - Microbiology 2020Quote: ... and a plasmid expressing VSV-G or HIVKB9 envelope glycoproteins were cotransfected at the mass ratio of 9:1 (9 Hi.fate / 1 Env) using Effectene (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... 1 mL of the 2-mL culture was removed and replaced by 1 mL of RNAprotect Cell Reagent (Qiagen). After 5 min of incubation ...
-
bioRxiv - Microbiology 2022Quote: ... 200 RPM for 2 h then approximately 1×109 CFU of bacteria were mixed at a 2:1 (vol:vol) ratio of RNAProtect (Qiagen) and incubated at room temperature for 5 min ...
-
bioRxiv - Physiology 2020Quote: ... insulin-like growth factor 1 receptor (Igf1r) and sirtuin 1 (Sirt1) gene promoters were designed using the Pyromark Assay Deisgn 2.0 software (Qiagen). PCR and sequencing primers are provided in Supplementary Table 1 ...
-
bioRxiv - Plant Biology 2022Quote: RNA was extracted from 10-day-old whole seedlings grown on 1/2X MS media containing 1% sucrose and 0.8% agar (Plant RNeasy kit (Qiagen)) ...
-
bioRxiv - Microbiology 2023Quote: TG was quantified in snap-frozen liver tissue stored at −80 □C until cryo-grinding in liquid nitrogen and 50 ±5 mg tissue added 0.9 mL of a 2:1 chloroform:methanol solution and homogenized 1 min at 50 os/sec using a TissueLyser LT (Qiagen) with beads ...
-
bioRxiv - Systems Biology 2023Quote: ... x mg solid matrix were mixed with five times the μl amount of ACN:water (1:1, v/v) and homogenised with a TissueLyser II (30 Hz, 10 min; Retsch Qiagen). After a short centrifugation (2 min ...
-
bioRxiv - Genetics 2022Quote: ... The tissue powder was then transferred to a 1.5 mL centrifuge tube where 400 μL of 1% PVP-40 Buffer AP1 solution and 4 μL of RNase A were added (Qiagen DNeasy Plant Kit Qiagen Inc, Hilden, Germany). The tube was initially vortexed to homogenize the solution before incubation at 65 °C for 30 minutes with a short vortex every 5 minutes.
-
bioRxiv - Pathology 2024Quote: ... by running one homogenization cycle (50 Hz oscillation frequency (50 cycles/s) for 4 minutes) in a Tissue lyser LT (Qiagen). Tubes were then centrifuged at 5000 rpm for 5 min ...
-
Sweetwater: an underrated crude glycerol for sustainable lipid production in non-conventional yeastsbioRxiv - Systems Biology 2023Quote: ... tubes were vortexed for 15 s and submitted to cell disruption for 15-min at 4°C using a TissueLyser II (Qiagen) at 30 Hz ...
-
bioRxiv - Immunology 2021Quote: Total RNA was isolated from 3×106 neutrophils by using the RNeasy Mini Kit (Qiagen). TaqMan real-time quantitative RT-PCR was performed utilizing the Applied Biosystems StepOne Plus cycler (Applied Biosystems ...
-
bioRxiv - Systems Biology 2020Quote: ... with 3 mm beads then extracted according to the protocol using RNeasy Mini Kit (Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... vIL-6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using QuantiTect Multiplex RT-PCR Kits (Qiagen) as described previously (37 ...
-
bioRxiv - Microbiology 2021Quote: ... 3 × 105 cells were harvested and total RNA was extracted using the RNeasy kit (Qiagen) employing on-column DNase treatment ...
-
The formation of a fuzzy complex in the negative arm regulates the robustness of the circadian clockbioRxiv - Molecular Biology 2022Quote: ... crassa strain 87-3 (bd+, mat a) using the Gentra Puregene Tissue kit (Qiagen, 158622) and following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Typhimurium strain were (n = 3) were extracted using the Rneasy kit (Qiagen Sciences, Maryland, USA), after an overnight culture in CBD tinted LB broth (for CBD-resistant strain ...
-
bioRxiv - Plant Biology 2023Quote: ... Two glass beads were added before shaking for 3 minutes using a Tissue Lyser (QIAGEN) at maximum speed ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were incubated for 3 minutes at 56°C in a deparaffinization solution (Qiagen, 19093). A step of digestion with Proteinase K was performed followed by a treatment with DNAses ...
-
bioRxiv - Genomics 2023Quote: ... 3) cleanup of final libraries with QIAgen MinElute PCR purification kit (QIAgen, Cat. No 28004), followed by a second cleanup with 2X SPRI ...
-
bioRxiv - Cancer Biology 2023Quote: ... Equivalent cell numbers (∼3 × 106) across all samples were harvested in QIAzol lysis reagent (Qiagen). Illumina gene expression raw data were transformed using variance- stabilizing transformation (VST ...
-
bioRxiv - Plant Biology 2022Quote: ... and roots of the cultivar Hoko-3 using RNeasy Plant Mini kit (Qiagen, Hilden, Germany). Library preparation was performed using NEBNext Single Cell/Low Input cDNA Synthesis & Amplification Module (New England Biolabs ...
-
bioRxiv - Immunology 2024Quote: ... Total RNA (3 independent samples per group) was isolated (QIAGEN miRNeasy mini extraction kit (QIAGEN) and cDNA was synthesized (High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems)) ...
-
bioRxiv - Immunology 2024Quote: ... Total RNA (3 independent samples per group) was isolated (QIAGEN miRNeasy mini extraction kit (QIAGEN) and cDNA was synthesized (High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The supernatant was then incubated with 3 ml of Ni-NTA Superflow agarose beads (QIAGEN), which were preequilibrated with bacterial lysis buffer ...
-
bioRxiv - Physiology 2024Quote: ... 3 mM benzamidine) with a steel bead7,17 using the TissueLyser II bead mill (Qiagen, USA) for 1 min at 30 Hz.
-
bioRxiv - Plant Biology 2024Quote: ... Leaf samples were collected in the well containing a 3 mm tungsten carbide bead (Qiagen) and 100 µl extraction buffer (200 mM Tris-HCl ...