Labshake search
Citations for TianGen Biotech :
251 - 300 of 545 citations for Human Procollagen Type III N Terminal Propeptide PIIINP ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: The genomic DNA of the isolated strain was extracted using a Bacterial DNA Kit (TIANGEN) and then submitted to Sangon Biotech (Shanghai ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was extracted from collected tissues using the RNAprep pure plant kit (TIANGEN, China). Qualified RNA per sample was used to generate sequencing libraries by NEBNext Ultr RNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Bioengineering 2021Quote: ... The quantitative PCR was conducted using the SuperReal PreMix SYBR Green kit (Tiangen Biotech, China) and the CFX96 Real-Time system (Bio-Rad ...
-
bioRxiv - Plant Biology 2020Quote: ... First-strand cDNA was synthesized using a Fast Quant RT Kit with gDNA Eraser (Tiangen). Genomic DNA was isolated from transgenic leaf tissues using the DNeasy Plant Mini Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2022Quote: ... and genomic DNA was isolated using a TIANamp Genomic DNA Kit (TianGen Biotech, Beijing, China) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA was extracted from dead seeds using the Plant Genomic DNA Kit (Tiangen, Beijing, China). The entire coding sequence of MvALS1 to MvALS5 was PCR-amplified as described by Iwakami et al ...
-
bioRxiv - Plant Biology 2021Quote: ... Total RNA was isolated using RNAprep Pure Plant Kit (Tiangen, Beijing, China, cat. no. DP432) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Mouse DNA was extracted from the liver using an extraction kit (DP341-01, Tiangen, China) as per the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2020Quote: ... Protein concentration was measured using Bradford protein assay kit (Tiangen Biotech, Beijing Co., LTD, CN). The purity of the PM was determined by standard marker assays[32] ...
-
bioRxiv - Immunology 2020Quote: ... and collected at 24 h) using the RNAsimple Total RNA Kit (Tiangen Biotech, Beijing, China) as described in the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... Total DNA was extracted using the TIANamp Genomic DNA Kit (TIANGEN BIOTECH [BEIJING] CO, LTD). DNA concentration and purity were measured with the NanoDrop2000 system (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... Fresh retinas were subjected to RNA extraction using RNAsimple Total RNA Kit (DP419, TIANGEN, China) per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: The total RNA was extracted using the RNA prep pure plant kit (Tiangen Biotech (Beijing) Co. ...
-
bioRxiv - Microbiology 2023Quote: ... Positive plasmid extracted from clones with correct sequence using TIANprep Mini Plasmid Kit II (Tiangen).
-
bioRxiv - Genomics 2023Quote: Total genomic DNA was extracted from leaf samples using the New Plant DNA Kit (TIANGEN). After DNA concentration and integrity were detected ...
-
bioRxiv - Genomics 2023Quote: ... Total RNA was extracted from flower and fruit using RNAprep Pure Plant Plus Kit (TIANGEN), cDNA libraries were constructed and sequenced by Illumina NovaSeq 6000 (Illumina ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was then extracted using the RNAprep Pure Plant Plus Kit (TIANGEN, Cat. #DP441), following the manufacturer’s instructions.
-
bioRxiv - Genomics 2024Quote: ... Total RNAs were extracted using an RNAprep Pure Plant Kit (Cat. no: 4992237; Tiangen, China). A cDNA library was constructed using the TIANSeq Fast RNA Library Prep Kit (Cat ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA was obtained according to the instructions of a TIANScript II RT kit (KR107, TIANGEN). The expression of transcripts of the target gene was measured by using a LightCycle® 96 instrument (Roche ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA was extracted from plants using RNA Easy Fast Plant Tissue Kit (Tiangen Biotech). First-strand cDNA was synthesized with a PrimeScript™ RT reagent kit with gDNA Eraser (Takara) ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA was isolated using the TIANamp Bacteria DNA Kit (TIANGEN Biotech Co., Ltd., China). LC-MS/MS technique was employed to detect DNA base modifications on the extracted E ...
-
Mutations in HUA2 restore flowering in the Arabidopsis trehalose 6-phosphate synthase1 (tps1) mutantbioRxiv - Plant Biology 2024Quote: Total RNA was extracted from Arabidopsis seedlings using the RNA Isolation Kit (Tiangen, China, DP441) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... and cDNA was synthesized by the FastKing cDNA First-Strand Synthesis Kit (TIANGEN, Beijing, China). qRT-PCR was performed using a SYBR Green PCR Master Mix kit on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Neuroscience 2022Quote: ... The strains were expanded and cultured with a TIANprep Mini Plasmid Kit (DP103, Tiangen, China). The known standard curves were used to quantify the initial amount of the target template of the unknown sample ...
-
bioRxiv - Bioengineering 2023Quote: The recombinant plasmids were extracted using the TIANprep Rapid Mini Plasmid Kit (TIANGEN, Beijing, China). Genomic DNAs of bacteria were extracted using the Wizard Genomic DNA Purification Kit (Promega ...
-
bioRxiv - Developmental Biology 2024Quote: Total RNA was extracted from oocytes or tissues using RNAprep Pure Micro Kit (Tiangen, DP420) or RNA Easy Fast Kit (Tiangen ...
-
bioRxiv - Cancer Biology 2024Quote: ... All DNA sequences were confirmed by sequencing after purification (EndoFree Maxi Plasmid Kit, TIANGEN Biotech). The sequences of these plasmids were listed in Table S1.
-
bioRxiv - Cancer Biology 2024Quote: ... The library plasmids were then extracted with the EndoFree Maxi Plasmid Kit (Tiangen, Cat# 4992194).
-
bioRxiv - Microbiology 2024Quote: ... cDNA was synthesized from 1 μg total RNA with a FastKing RT Kit (TianGen Biotechnology) and subject to RT-qPCR ...
-
bioRxiv - Microbiology 2024Quote: ... The bacteria genomic DNA was extracted using the TIANamp Genomic DNA Kit (TIANGEN, Beijing, China) from bacteria ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Recombinant plasmids extracted from yeast using TIAN prep Mini Plasmid Kit (TIANGEN BIOTECH, Beijing, China) and High Pure BAC DNA Mini Kit (Magen Biotechnology ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA of harvested cultures was extracted using the TIANamp Bacteria DNA kit (Tiangen Biotech). PCR primers VPA0427SNPU (AGCGACGACGCCAGAGAAAG ...
-
High-resolution chromosome-level genome provides molecular insights into adaptive evolution in crabsbioRxiv - Genomics 2024Quote: ... the resulting DNA fragments were purified using the TIAN quick mini purification kit (Tiangen Biotech). After purification ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA was extracted from the bacterial suspension using a DNA extraction kit (Tiangen, China) and subsequently subjected to PCR using universal 16s rRNA primers [18] ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA extraction from plants was isolated with the RNAprep Pure Plant Kit (TIANGEN DP432). cDNA was synthesized using 1 µg of total RNA by utilizing the FastQuant RT Kit (with gDNase ...
-
bioRxiv - Bioengineering 2024Quote: ... The plasmids were extracted from the colonies using the TIANprep Mini Plasmid Kit (Tiangen, DP103).
-
bioRxiv - Molecular Biology 2024Quote: ... The library plasmids were then extracted with Endo-Free Maxi-prep Plasmid Kit (TIANGEN, 4992194). Step II ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA was extracted from organoid samples using an RNAprep Pure Micro Kit (DP420, Tiangen Biotech). The libraries were generated according to the manufacturer’s protocol of NEBNext Ultra Directional RNA Library Prep Kit for Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... The protein concentration was determined with the BCA Protein Assay Kit (Tiangen Biotech Co., Ltd).
-
bioRxiv - Microbiology 2020Quote: The DNA and RNA of virus were extracted by using TIANamp Virus DNA / RNA Kit (TIANGEN) according to the manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2021Quote: ... Total DNA was extracted from the tail using a TIANamp Genomic DNA kit (TIANGEN, Beijing, China) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... max roots were harvested and total RNA was extracted using an RNAprep Plant plus Kit (Tiangen), and 1st strand cDNA was synthesized using Transcript One-Step gDNA Removal and cDNA Synthesis super Mix Kit (TransGen Biotech.) ...
-
bioRxiv - Evolutionary Biology 2022Quote: Total RNA was isolated from muscle tissues in offspring using RNAprep Pure Tissue Kit (TIANGEN, Beijing). According to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... and the RNAprep Pure polysaccharide polyphenol plant total RNA extraction kit (TIANGEN Co., Ltd., Beijing, China) was used to extract total RNA.
-
bioRxiv - Genomics 2021Quote: Total RNA was extracted and purified with the RNAprep Pure Plant Kit (Tiangen Biotech, Beijing, China). Poly(A)+ mRNA was enriched with oligo (dT ...
-
bioRxiv - Genomics 2021Quote: Total RNA was extracted and purified with the RNAprep Pure Plant Kit (Tiangen Biotech, Beijing, China) from each sample list in Supplemental Table S2 ...
-
bioRxiv - Bioengineering 2021Quote: ... The total RNA was then extracted using an RNAprep Pure Cell/Bacteria Kit (Tiangen Biotech, China). The extracted total RNA was then treated with DNase I to remove the genomic DNA and used as a template for cDNA synthesis with random primers and SuperScriptTMIII Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Synthetic Biology 2021Quote: ... plasmid extraction was performed following the manuals of the TIANprep Mini Plasmid Kit (TIANGEN, DP103-02) or AxyPrep Plasmid Miniprep Kit (AXYGEN ...
-
bioRxiv - Microbiology 2020Quote: ... All the DNA samples were purified through a DNA kit column (DP214-02, Tiangen, Beijing, China) and kept at −20°C until further analysis (6) ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR product was purified and directly recombined by the EasyGeno recombinant clone kits (Cat:VI201, Tiangen). After conventional transformation and monoclonal screening of positive bacteria ...