Labshake search
Citations for Eurogentec :
51 - 100 of 134 citations for rno mir 542 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... PCR primers were purchased from Eurogentec and used in PCRs with SYBR Green Master Mix (ThermoFisher ...
-
bioRxiv - Microbiology 2019Quote: ... Mesa Green qRT-PCR MasterMix (Eurogentec) was added to the cDNA (5 μl for every 2 μl of cDNA) ...
-
bioRxiv - Genetics 2022Quote: ... containing 1× PCR buffer (Silverstar, Eurogentec), 1.5 mm MgCl2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... A 25 μl reaction volume was prepared for each reaction using the Low ROX One-Step qRT-PCR 2X MasterMix kit (Eurogentec®, Seraing, Belgium) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... A 25 µl reaction volume was prepared for each reaction using the Low ROX One-Step qRT-PCR 2X MasterMix kit (Eurogentec®, Seraing, Belgium) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... a 20 µl mixture containing 3 µl of RNA was prepared using the Low ROX One-Step qRT-PCR 2X MasterMix kit (Eurogentec®, Seraing, Belgium) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... capture and detection antibody was the same affinity-purified custom anti-(GP)8 antibody (Eurogentec, biotinylated for detector). For polyGA ...
-
bioRxiv - Cell Biology 2023Quote: ... CD79α and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was measured by RT-qPCR using Takyon SYBR Master Mix (Eurogentec), 100nM of specific primers ...
-
bioRxiv - Physiology 2023Quote: ... Messenger RNA (mRNA) expression levels were assessed by quantitative polymerase chain reaction (RT-qPCR) using Takyon SYBR green (Eurogentec) (primers indicated in supplemental table 1 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... RT-qPCR was performed on the Stratagene 500 MX3005P using a SYBR Green reaction mix (Eurogentec, Cat#10-SN2X-03T). The primers used for mRNA detection of target genes by RT-qPCR are listed in Table S1 ...
-
bioRxiv - Microbiology 2021Quote: ... one-step qPCR assay was performed using 5 μL of RNA and Takyon Low rox one-step RT probe Mastermix (Eurogentec) and specific primers and probe targeting E gene ...
-
bioRxiv - Microbiology 2024Quote: ... All RT-qPCR assays were carried out in 96-well plates using MESA Blue qPCR MasterMix Plus for SYBR Assay (Eurogentec). GLuc was amplified using GLuc forward primer CCTACGAAGGCGACAAAGAG and reverse primer TTGTGCAGTCCACACACAGA and results were normalised by amplifying 18s primer sequences ...
-
bioRxiv - Immunology 2021Quote: ... 10 µl of SYBR Green PCR reaction mix (Eurogentec), including 100 ng of the synthesized cDNA plus an appropriate oligonucleotide primer pair ...
-
bioRxiv - Plant Biology 2020Quote: ... The PCR mix contained Takyon qPCR master mix (Eurogentec), 500 nM gene-specific primers ...
-
bioRxiv - Plant Biology 2020Quote: ... RT-qPCR experiments were performed with 4µL of cDNA combined to the Takyon No Rox SYBR MasterMix (Eurogentec, UF-NSMT-B0701), using a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Plant Biology 2019Quote: ... Quantitative PCRs were performed using Mesa Green qPCR MasterMix (Eurogentec) in 384-well plates with a Quantstudio Q5 system (Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... were added by PCR using HGS Diamond Taq DNA polymerase (Eurogentec). The samples were purified and eluted in 35 μl of EB buffer (MinElute PCR Purification Kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNAs were amplified by Q-PCR using 5’ and 3’ oligonucleotides (Eurogentec) specific to each gene ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative PCR reactions were performed with SYBR Mesa Blue qPCR Mastermix (Eurogentec). Three technical replicates were prepared for each sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... The RT-qPCR amplification was carried out with the dsDNA-specific dye Takyon™ SYBR® 2X qPCR Mastermix Blue (Eurogentec Cat#UF-FSMT-B0701) and monitored in real-time with a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR amplification was conducted using MESA Green qPCR MasterMix Plus Assay (Eurogentec Ltd.) on a DNA Engine Opticon2 thermocycler (BioRad) ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR mix consisted of 1X Goldstar™ DNA polymerase (Eurogentec, Seraing, Belgium) and 400 nM of each primer ...
-
Ion transport modulators differentially modulate inflammatory responses in THP-1 derived macrophagesbioRxiv - Immunology 2021Quote: ... Quantitative PCR was performed using the Mesa green qPCR master mix (Eurogentec, Seraing, Germany). All primer sequences were obtained from Primerbank (Table 2) ...
-
bioRxiv - Cell Biology 2019Quote: ... mRNA expression was measured by quantitative (Q)-PCR using SYBR Green Mastermix (Eurogentec Ltd.) and the DNA Engine Opticon 2 system (BioRad) ...
-
bioRxiv - Bioengineering 2023Quote: ... qRT-PCR was performed using Takyon Blue dTTP Master Mix (Eurogentec, #UF-NSMT-B0701). The primer sequencesare provided in Supplementary Table 2 ...
-
bioRxiv - Genomics 2020Quote: ... PCR amplification was conducted using MESA Green qPCR MasterMix Plus for SYBR Assay (Eurogentec Ltd.) on a DNA Engine Opticon2 thermocycler (BioRad) ...
-
bioRxiv - Developmental Biology 2022Quote: ... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec).
-
bioRxiv - Neuroscience 2022Quote: ... For qRT-PCR analysis the MESA BLUE qPCR MasterMix Plus for SYBR® Assay (Eurogentec) with 100 ng cDNA as template was used ...
-
bioRxiv - Microbiology 2020Quote: ... Extracted DNA was incorporated into real-time PCR performed using Metha_16S_2_MBF: 5’-CGAACCGGATTAGATACCCG -3’ and Metha_16S_2_MBR: 5’-CCCGCCAATTCCTTTAAGTT-3’ primers (Eurogentec, Angers, France) and FAM_Metha_16S_2_MBP 6FAM-CCTGGGAAGTACGGTCGCAAG probe targeting the 16S DNA gene of methanogens ...
-
bioRxiv - Plant Biology 2023Quote: ... Quantitative PCR reactions were carried out using Takyon Low ROX SYBR 2X MasterMix blue dTTP (Eurogentec, Belgium) with a AriaMx real-time PCR system (Agilent Technologies ...
-
bioRxiv - Cell Biology 2023Quote: qRT-PCR reactions were prepared using 1x MESA Blue qPCR MasterMix Plus for SYBR® Assay (Eurogentec), 0.1 µl ROX Reference Dye (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2µl of PCR product was denatured in 10µl HiDi formamide (Thermo) with 0.5µl Mapmarker ROX 1000 (Eurogentec) and run on an ABI 3730XL genetic analyser ...
-
bioRxiv - Physiology 2019Quote: ... cDNA-specific PCR primers were designed using Primer-BLAST (see Table 1) and purchased from Eurogentec (Seraing, Belgium). Gapdh was used as reference gene ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 U of HotGoldStar polymerase and SYBR Green PCR mix as per the manufacturer’s recommendations (Eurogentec, Seraing, Belgium). Amplification was performed as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... random nonamers (Eurogentec Reverse Transcriptase Core Kit) was used to prepare cDNA by using the 200 ng of the total RNA for 10 μl of reaction and the produced cDNA was used for comparative quantitation of mRNA expression ...
-
bioRxiv - Cell Biology 2020Quote: A PLA kit II (Eurogentec, Seraing, BE) was used according to the manufacturer’s instructions with slight modifications ...
-
bioRxiv - Biochemistry 2021Quote: ... Forward and reverse primers for the PCR reaction were designed using the online rf-cloning.org service and purchased from Eurogentec.
-
bioRxiv - Molecular Biology 2020Quote: ... mRNA real time quantification was generally performed in a two step format using Eurogentec Reverse Transcriptase Core Kit and MESA GREEN qPCR Master Mix Plus for SYBR Assay with Low Rox kit from Eurogentec following the suppliers’ protocols ...
-
bioRxiv - Cancer Biology 2021Quote: ... mRNA real time quantification was generally performed in a two step format using Eurogentec Reverse Transcriptase Core Kit and MESA GREEN qPCR Master Mix Plus for SYBR Assay with Low Rox kit from Eurogentec following the suppliers’ protocols ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time (reverse transcriptase) PCR from cDNA was done with the Mesa Green qPCR Mastermix Plus for SYBR Assay-Low ROX (Eurogentec). For real time based quantification to study comparative differential expression here are list of primers that has been used ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative PCR was performed using primers listed in Table S2 and TakyonLow Rox SYBR MasterMix blue (Eurogentec #UF-LSMT-B0701). Samples were run on an ABI ViiA 7 cycler ...
-
bioRxiv - Genomics 2019Quote: ... All quantitative PCR assays were performed in duplicate with Mesa green qPCR 2x MasterMix Plus (Eurogentec 05-SY2X-06+WOU) on a CFX96 PCR system (Bio-Rad ...
-
bioRxiv - Plant Biology 2020Quote: ... which also contained 10 µl of the Power SYBR green PCR master mix of qPCR master mix plus for SYBR Green I (Eurogentec, Seraing ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative PCR was then performed using an ABI7500 Fast instrument and the MESA Green qPCR MasterMix Plus for SYBR assay (Eurogentec). Relative expression was calculated via the Pfaffl method79 using Gapdh and Polr2a as references gene ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real-time (reverse transcriptase) PCR from cDNA was done with the Mesa Green qPCR Mastermix Plus for SYBR Assay-Low ROX (Eurogentec). 18s rRNA has been used as endogenous control.
-
bioRxiv - Microbiology 2021Quote: ... DNA eluted into 100 μl sample volume was tested in quantitative-PCRs (qPCRs) using primers and probes (Eurogentec, Seraing, Belgium) targeting sequences within metA ...
-
bioRxiv - Microbiology 2022Quote: ... All qRT-PCR assays were carried out in 96-well plates using MESA Blue qPCR MasterMix Plus for SYBR Assay (Eurogentec). Primers for viral genes are shown in Table 1 ...
-
bioRxiv - Plant Biology 2023Quote: Each quantitative PCR reaction was performed in three technical replicates with Takyon™ SYBR® 2X qPCR Mastermix Blue (Eurogentec) in 384-wells plates with a total volume of 10 uL using Light Cycler 480 apparatus (Roche) ...
-
bioRxiv - Cell Biology 2024Quote: ... The RNAi target fragments were amplified by PCR from synthesised copies of TbMYO1 and TbMYO21 in a pUC57 plasmid (Eurogentec). The fragments were ligated into Eam1105I-cut p2T7_TAblue using in vivo assembly (IVA ...
-
bioRxiv - Microbiology 2024Quote: An amount of 2 μL of cDNA was then used for quantitative PCR with the MESA GREEN qPCR MasterMix Plus (Eurogentec) and primers for AID (Forward 5′ AATTCAAAAATGTCCGCTGGGC*T3′ ...