Labshake search
Citations for Eurogentec :
51 - 100 of 157 citations for rno mir 143 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Primers and probe were provided by Eurogentec (Angers, France). TaqMan RT-qPCR assays were performed in a total volume of 25 μL containing 2.5 μL of RNA sample ...
-
bioRxiv - Cell Biology 2024Quote: ... and specifically designed primers (Eurogentec, Liège, Belgium; Millipore Sigma) listed in Table 1 were used ...
-
MYB68 orchestrates cork differentiation by regulating stem cell proliferation and suberin depositionbioRxiv - Plant Biology 2024Quote: ... For qPCR MESA blue (Eurogentec, RT-SYS2X-03-+NRWOUB) was used ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The sequences of the primers used (synthesis by Eurogentec®) are available in the Table s1.
-
bioRxiv - Immunology 2022Quote: ... with the primers described in the Key resource table (Eurogentec).
-
bioRxiv - Cancer Biology 2021Quote: ... RT-qPCR was carried out using Mesa Blue mastermix (Eurogentec). All reactions were normalised to Gapdh as a control.
-
bioRxiv - Biochemistry 2022Quote: ... The primer sequences used for these experiments were synthesized by Eurogentec and are shown in Table S4.
-
bioRxiv - Molecular Biology 2019Quote: ... The DNA template and T7 promotor primer were purchased from Eurogentec. The transcript was purified by ion exchange chromatography (MonoQ ...
-
bioRxiv - Cancer Biology 2023Quote: ... Oligonucleotides and indexing primers were synthesized and HPLC-purified by Eurogentec.
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with Euroscript Reverse Transcriptase/RNase inhibitor (Eurogentec, RT-0125-ER) for reverse transcription of RNA ...
-
bioRxiv - Cell Biology 2020Quote: ... RT-qPCR was performed using MESA Blue SYBR Green Mastermix (Eurogentec). Pre-designed primers were purchaced from OriGene Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative PCRs were performed using Takyon SYBR Green PCR Mastermix (Eurogentec) on a StepOne thermocycler (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2019Quote: ... Primers (detailed in Supplementary data, Supplementary Table 1) were purchased from Eurogentec (France).
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5μl of 10pmoles/μl of internal control forward primer (MS2) (supplied by Eurogentec), 0.5μl of 10pmoles/μl internal control reverse primer (MS2) ...
-
bioRxiv - Microbiology 2019Quote: ... 1.25 μL of 10 μM primers (reported in Table 1) (Eurogentec, Seraing, Belgium) and 1.25 μL of water ...
-
bioRxiv - Immunology 2020Quote: ... qPCR assays were performed using primers purchased from Eurogentec (Seraing, Belgium; Table 1) and specific for the gene coding for the flaA and flaB subunit genes ...
-
bioRxiv - Molecular Biology 2019Quote: ... For RT-qPCR the MESA Blue qPCR MasterMix Plus kit was used (Eurogentec). For each gene MESA Blue was mixed with 100nM forward and reverse primers (refer to table 2.2) ...
-
bioRxiv - Plant Biology 2024Quote: ... RT-qPCR experiments were performed using TakyonTM Low ROX SYBR MasterMix (Eurogentec, Belgium) with the AriaMx Real-Time PCR system (Agilent Technologies ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR was performed on a Applied Biosystems™ QuantStudio™ 5 Real-Time PCR System with SYBR Green PCR MasterMix (Eurogentec). Each reaction was performed on a 1:20 dilution of the cDNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1 mM mixed primers (Ef2/Er3/L3f/Lxr, 1:1:1:1, Eurogentec, France), 1x Q solution and 0.017 units of HotStar Taq Plus DNA polymerase (Qiagen ...
-
bioRxiv - Cancer Biology 2022Quote: ... The resulting cDNA was used in conjunction with MegaMix-Blue and P2RY2 primers (Eurogentec; Forward sequence ...
-
bioRxiv - Microbiology 2023Quote: Forward primers were marked in 5’ with 6-FAM or HEX fluorophores (Eurogentec®) and when useful ...
-
bioRxiv - Neuroscience 2021Quote: ... The reaction mixture for real-time PCR contained Takyon real-time PCR mastermix (Eurogentec) and Taqman primer/probe mix (Applied Biosystems ...
-
bioRxiv - Physiology 2021Quote: ... Real-time qPCRs were performed using sequence-specific primers supplied by Eurogentec (see supplementary material) with SsoAdvancedTM Universal SYBR® Green Supermix in a CFX-ConnectTM Real-Time System (Biorad).
-
bioRxiv - Developmental Biology 2022Quote: ... or HotGoldStar PCR mix (Eurogentec) using 50 ng total RNA equivalent RT reaction and Endoglin EngExon12fwd 5’-CTGGGCATAGCGTTCGGAGGATT-3’ ...
-
bioRxiv - Microbiology 2019Quote: ... Mesa Green qRT-PCR MasterMix (Eurogentec) was added to the cDNA (5 μl for every 2 μl of cDNA) ...
-
bioRxiv - Genetics 2022Quote: ... containing 1× PCR buffer (Silverstar, Eurogentec), 1.5 mm MgCl2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and primers for target mRNA, namely: Ntrk2 (NM_001025074) and Ppia (CyCA, NM_012583) provided by Eurogentec (Seraing, Belgium). The difference in mean threshold cycle (Δ Ct ...
-
bioRxiv - Genetics 2023Quote: ... Target sequences (primer list in Additional file 6) were amplified with MESA BLUE qPCR MasterMix Plus (Eurogentec) or KAPA SYBR FAST Roche LightCycler 480 qPCR Master Mix (Kapa Biosystems ...
-
bioRxiv - Biochemistry 2022Quote: ... cDNAs were used with 0.1µM of each primer (forward and reverse) and 2X MESA Blue qPCR mix (Eurogentec) in a 20µl final qPCR reaction ...
-
bioRxiv - Pathology 2024Quote: ... The optimal primer concentration was 300 nM with MESA Green qPCRTM Mastermix Plus for SYBR® Assays (Eurogentec) and 100 nM for TaqMan® probes ...
-
bioRxiv - Cell Biology 2023Quote: ... CD79α and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was measured by RT-qPCR using Takyon SYBR Master Mix (Eurogentec), 100nM of specific primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... according to the manufacturer’s instructions and as described in [52] and using the primer pairs (10 nmol, RP-cartridge Gold, Eurogentec) Naa40a120c forward ...
-
bioRxiv - Biochemistry 2023Quote: ... as previously described46 whereas DNA templates for pre-tRNAIle and tRNAIle and T7 promotor primer were purchased from Eurogentec. RNA transcripts were purified by ion exchange chromatography (MonoQ™ 10/100 GL ...
-
bioRxiv - Physiology 2023Quote: ... Messenger RNA (mRNA) expression levels were assessed by quantitative polymerase chain reaction (RT-qPCR) using Takyon SYBR green (Eurogentec) (primers indicated in supplemental table 1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Used miRNA primers in this study has been validated in previous publications [18] and supplied by Eurogentec (Supplementary Table 1). mRNA and miRNA data sets were compared with the designated control utilising housekeeping genes GAPDH or RnU6 as detailed in Figure legends.
-
bioRxiv - Evolutionary Biology 2019Quote: ... RT-qPCR was performed on the Stratagene 500 MX3005P using a SYBR Green reaction mix (Eurogentec, Cat#10-SN2X-03T). The primers used for mRNA detection of target genes by RT-qPCR are listed in Table S1 ...
-
bioRxiv - Microbiology 2021Quote: ... one-step qPCR assay was performed using 5 μL of RNA and Takyon Low rox one-step RT probe Mastermix (Eurogentec) and specific primers and probe targeting E gene ...
-
bioRxiv - Microbiology 2024Quote: ... All RT-qPCR assays were carried out in 96-well plates using MESA Blue qPCR MasterMix Plus for SYBR Assay (Eurogentec). GLuc was amplified using GLuc forward primer CCTACGAAGGCGACAAAGAG and reverse primer TTGTGCAGTCCACACACAGA and results were normalised by amplifying 18s primer sequences ...
-
bioRxiv - Immunology 2021Quote: ... 10 µl of SYBR Green PCR reaction mix (Eurogentec), including 100 ng of the synthesized cDNA plus an appropriate oligonucleotide primer pair ...
-
bioRxiv - Plant Biology 2020Quote: ... The PCR mix contained Takyon qPCR master mix (Eurogentec), 500 nM gene-specific primers ...
-
bioRxiv - Genetics 2023Quote: ... and then a Takyon SYBR Green PCR kit (Eurogentec) in a StepOnePlus apparatus (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2021Quote: ... mRNA qPCR was performed on 5 µl 10x diluted CDNA by employing a final concentration of 300 nM of each primer in 20 µl reaction on ABI 7700 sequence detector using MESA Blue SYBR Green reagent (Eurogentec, Belgium) using the following protocol ...
-
bioRxiv - Immunology 2022Quote: ... The total RNA yield of each sample was converted to cDNA using a template-switch oligo primer (TSO) (Eurogentec, Seraing, Belgium), RNAsin (Promega ...
-
bioRxiv - Plant Biology 2022Quote: ... First-strand cDNAs were synthesized from 1 μg of total RNA in 20 μl final volume using an oligo-dT(18)-MN primer (Eurogentec, France) and the Omniscript RT kit (Qiagen) ...
-
bioRxiv - Plant Biology 2020Quote: ... RT-qPCR experiments were performed with 4µL of cDNA combined to the Takyon No Rox SYBR MasterMix (Eurogentec, UF-NSMT-B0701), using a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Genetics 2021Quote: ... The number of DR copies per cell in iciHHV-6B DNA was determine by ddPCR with primers DR6B-F and DR6B-R and DR6B FAM-labelled hydrolysis probe (Eurogentec, Liège, Belgium) together with the HEX- labelled RPP30 reference probe (Bell et al. ...
-
bioRxiv - Genomics 2020Quote: ... A snoRNA-specific forward primer and a universal reverse primer (RTQ-UNIR, matched to the Tm of each snoRNA) were used for the amplification of each target (all Eurogentec, Seraing, Belgium) (Primer sequences are in Supplementary File 1) ...
-
bioRxiv - Immunology 2022Quote: ... Real-time PCR was performed with 5x MESA Green (Eurogentec) on Bio-Rad CFX 96 Realtime PCR system ...
-
bioRxiv - Plant Biology 2019Quote: ... Quantitative PCRs were performed using Mesa Green qPCR MasterMix (Eurogentec) in 384-well plates with a Quantstudio Q5 system (Applied Biosystems ...