Labshake search
Citations for Eurogentec :
101 - 150 of 157 citations for hsa mir 940 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... virus-specific primers (HHV-6B POL F and HHV-6B POL R) and FAM-labelled HHV-6B POL (U38) probe (Eurogentec; Supplementary Table 6) at 300 nM and 200 nM respectively ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... were added by PCR using HGS Diamond Taq DNA polymerase (Eurogentec). The samples were purified and eluted in 35 μl of EB buffer (MinElute PCR Purification Kit ...
-
bioRxiv - Genomics 2021Quote: ... in a final volume of 10 µL (0.5 µL of each primer, 5 µL of Eurogentec Takyon™ SYBR® 2 x qPCR Mastermix Blue). The following Light-Cycler run protocol was used ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNAs were amplified by Q-PCR using 5’ and 3’ oligonucleotides (Eurogentec) specific to each gene ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative PCR reactions were performed with SYBR Mesa Blue qPCR Mastermix (Eurogentec). Three technical replicates were prepared for each sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... The RT-qPCR amplification was carried out with the dsDNA-specific dye Takyon™ SYBR® 2X qPCR Mastermix Blue (Eurogentec Cat#UF-FSMT-B0701) and monitored in real-time with a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative real-time PCR (qPCR) using a SYBR Green core qPCR kit (Eurogentec) and an ABI Prism 7000 machine (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR amplification was conducted using MESA Green qPCR MasterMix Plus Assay (Eurogentec Ltd.) on a DNA Engine Opticon2 thermocycler (BioRad) ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR mix consisted of 1X Goldstar™ DNA polymerase (Eurogentec, Seraing, Belgium) and 400 nM of each primer ...
-
bioRxiv - Developmental Biology 2020Quote: ... The cDNA was then submitted to quantitative real time PCR using Sybrgreen technology (Eurogentec) on a Stepone apparatus (Applied Biosystems ...
-
Ion transport modulators differentially modulate inflammatory responses in THP-1 derived macrophagesbioRxiv - Immunology 2021Quote: ... Quantitative PCR was performed using the Mesa green qPCR master mix (Eurogentec, Seraing, Germany). All primer sequences were obtained from Primerbank (Table 2) ...
-
bioRxiv - Cell Biology 2019Quote: ... mRNA expression was measured by quantitative (Q)-PCR using SYBR Green Mastermix (Eurogentec Ltd.) and the DNA Engine Opticon 2 system (BioRad) ...
-
bioRxiv - Bioengineering 2023Quote: ... qRT-PCR was performed using Takyon Blue dTTP Master Mix (Eurogentec, #UF-NSMT-B0701). The primer sequencesare provided in Supplementary Table 2 ...
-
bioRxiv - Genomics 2020Quote: ... PCR amplification was conducted using MESA Green qPCR MasterMix Plus for SYBR Assay (Eurogentec Ltd.) on a DNA Engine Opticon2 thermocycler (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... Real time PCR was performed using Takyon No Rox Sybr 2X masterMix blue dTTp (Eurogentec) with 200 nM of each primer on an iCycler iQ(Bio-Rad) ...
-
bioRxiv - Neuroscience 2022Quote: ... For qRT-PCR analysis the MESA BLUE qPCR MasterMix Plus for SYBR® Assay (Eurogentec) with 100 ng cDNA as template was used ...
-
bioRxiv - Plant Biology 2019Quote: ... cDNA was then amplified by real time PCR reactions using Takyon SYBR Green Supermix (Eurogentec®) and gene-specific primers ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative real-time PCR was performed at 60°C using Takyon ROX SYBR MasterMix (Eurogentec, Belgium) in the CFX384 Touch Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: ... Real-time PCR reactions were performed in duplicate using Takyon ROX SYBR MasterMix blue dTTP (Eurogentec) on an Applied Biosystems QuantStudio 5 (Thermo Fischer Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... Real-time PCR reactions were performed in duplicate using Takyon ROX SYBR MasterMix blue dTTP (Eurogentec) on an Applied Biosystems QuantStudio 5 (ThermoFisher) ...
-
bioRxiv - Immunology 2019Quote: ... The expression of CPT1 was determined using PCR SYBR Green sequence detection system (Eurogentec, Seraing, Belgium) and the CFX Connect™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Molecular Biology 2019Quote: ... Quantitative Real time PCR (qPCR) was performed using Takyon ROX SYBR 2X MasterMix (Eurogentec UF-RSMT-B0701) as a fluorescent detection dye ...
-
bioRxiv - Plant Biology 2023Quote: ... Quantitative PCR reactions were carried out using Takyon Low ROX SYBR 2X MasterMix blue dTTP (Eurogentec, Belgium) with a AriaMx real-time PCR system (Agilent Technologies ...
-
bioRxiv - Plant Biology 2023Quote: ... We conducted qRT-PCRs with the Takyon No ROX SYBR MasterMix blue dTTP Kit (Eurogentec, Seraing, Belgium) in a LightCycler 480 II (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... 2µl of PCR product was denatured in 10µl HiDi formamide (Thermo) with 0.5µl Mapmarker ROX 1000 (Eurogentec) and run on an ABI 3730XL genetic analyser ...
-
bioRxiv - Cell Biology 2023Quote: qRT-PCR reactions were prepared using 1x MESA Blue qPCR MasterMix Plus for SYBR® Assay (Eurogentec), 0.1 µl ROX Reference Dye (Invitrogen) ...
-
bioRxiv - Plant Biology 2021Quote: ... qRT-PCR was performed us- ing the Takyon No ROX SYBR MasterMix blue dTTP Kit (Eurogentec, Seraing, Belgium) and the LightCycler 480 II (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... qRT-PCR was performed in a Roche LightCycler 480 Instrument II using the Takyon LowROX SYBR kit (Eurogentec). All qRT-PCR experiments were conducted with 3 biological replicates and 3 technical replicates ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 U of HotGoldStar polymerase and SYBR Green PCR mix as per the manufacturer’s recommendations (Eurogentec, Seraing, Belgium). Amplification was performed as follows ...
-
bioRxiv - Cell Biology 2020Quote: ... Real-time PCR was performed in a 20 μL final volume using the Takyon No Rox SYBR kit (Eurogentec). Fluorescence intensity was recorded using a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Plant Biology 2024Quote: ... Quantitative real-time PCR was performed at 60°C using Takyon No ROX SYBR 2X MasterMix blue dTTP (Eurogentec) in the LightCycler 480 (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... qRT-PCR was performed using Takyon Rox SYBR 2x Master mix blue dTTP kit (Eurogentec Cat# UF-RSMT-B0701), with starting concentrations of template of around 10ng/µl and primer concentrations of 0.5µM ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time (reverse transcriptase) PCR from cDNA was done with the Mesa Green qPCR Mastermix Plus for SYBR Assay-Low ROX (Eurogentec). For real time based quantification to study comparative differential expression here are list of primers that has been used ...
-
bioRxiv - Genomics 2019Quote: ... All quantitative PCR assays were performed in duplicate with Mesa green qPCR 2x MasterMix Plus (Eurogentec 05-SY2X-06+WOU) on a CFX96 PCR system (Bio-Rad ...
-
bioRxiv - Plant Biology 2020Quote: ... which also contained 10 µl of the Power SYBR green PCR master mix of qPCR master mix plus for SYBR Green I (Eurogentec, Seraing ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative PCR was then performed using an ABI7500 Fast instrument and the MESA Green qPCR MasterMix Plus for SYBR assay (Eurogentec). Relative expression was calculated via the Pfaffl method79 using Gapdh and Polr2a as references gene ...
-
bioRxiv - Microbiology 2020Quote: ... Lentiviruses were titrated by SYBR green I-based real-time PCR-enhanced reverse transcriptase (SG-PERT) assay (29, 30) using the Takyon SYBR green kit (Eurogentec). The titer was determined by comparison with a standard curve of known RNA concentrations ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real-time (reverse transcriptase) PCR from cDNA was done with the Mesa Green qPCR Mastermix Plus for SYBR Assay-Low ROX (Eurogentec). 18s rRNA has been used as endogenous control.
-
bioRxiv - Developmental Biology 2022Quote: ... ChIP-qPCRs were carried out in a CFX96TM Real-Time PCR Detection System (Bio Rad) using TakyonTM No Rox SYBR MasterMix dTTP Blue (Eurogentec). Oligonucleotide primers used for ChIP-qPCR are listed in Supplementary Table 1.
-
bioRxiv - Microbiology 2022Quote: ... All qRT-PCR assays were carried out in 96-well plates using MESA Blue qPCR MasterMix Plus for SYBR Assay (Eurogentec). Primers for viral genes are shown in Table 1 ...
-
bioRxiv - Plant Biology 2023Quote: Each quantitative PCR reaction was performed in three technical replicates with Takyon™ SYBR® 2X qPCR Mastermix Blue (Eurogentec) in 384-wells plates with a total volume of 10 uL using Light Cycler 480 apparatus (Roche) ...
-
bioRxiv - Cell Biology 2024Quote: ... The RNAi target fragments were amplified by PCR from synthesised copies of TbMYO1 and TbMYO21 in a pUC57 plasmid (Eurogentec). The fragments were ligated into Eam1105I-cut p2T7_TAblue using in vivo assembly (IVA ...
-
bioRxiv - Microbiology 2024Quote: An amount of 2 μL of cDNA was then used for quantitative PCR with the MESA GREEN qPCR MasterMix Plus (Eurogentec) and primers for AID (Forward 5′ AATTCAAAAATGTCCGCTGGGC*T3′ ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was used for real-time PCR analysis using Takyon Low Rox Probe 2x Master Mix dTTP Blue (Eurogentec, Liège, Belgium) with TaqMan® Assay-on-demand kits (Applied Biosystems ...
-
bioRxiv - Cell Biology 2019Quote: ... Relative copy numbers of the single-copy nuclear-encoded gene beta-2-microglobulin (β2M) and the mitochondrially-encoded gene mtND1 were measured by quantitative (Q)-PCR using SYBR Green Mastermix (Eurogentec Ltd.) and the DNA Engine Opticon 2 system (BioRad) ...
-
bioRxiv - Microbiology 2022Quote: ... All qRT-PCR assays were carried out in 96-well plates using Takyon™ No ROX SYBR 2X MasterMix blue dTTP (Eurogentec). Primers for cellular and viral genes are shown in S1 table ...
-
bioRxiv - Developmental Biology 2022Quote: ... was performed in a CFX96™ Real-Time PCR Detection System (Bio Rad) using TakyonTM No Rox SYBR MasterMix dTTP Blue (Eurogentec). Expression levels were normalised to the reference genes At5G25760 and At4G34270 70 ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was amplified in a 20 µl PCR mix containing 10 µl of Takyon Low Rox SYBR MasterMix dTTP Blue (Eurogentec, Belgium), 2 µl of each primer (final concentration 300 nM) ...
-
bioRxiv - Plant Biology 2023Quote: Gene expressions were measured by mixing 4.3 µL of a 100 fold diluted cDNA suspension with 7.5 µL of MESA Blue 2X PCR MasterMix for SYBR Green Assays with fluorescein (Eurogentec, Liege, Belgium). The mix is complemented with 3 µL of primers according to the optimal concentration allowing an efficiency close to 100% and calculated in previous experiments ...
-
bioRxiv - Immunology 2020Quote: ... The expression of the genes of hexokinase 2 (HK2) and LDH-A was determined using PCR SYBR Green sequence detection system (Eurogentec, Seraing, Belgium) and the CFX Connect™ Real-Time PCR Detection System (Bio-Rad ...