Labshake search
Citations for Eurogentec :
51 - 78 of 78 citations for Synthetic Apoptosis Regulator Bcl 2 BCL2 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... The anti-RpREC8 was a combination of two antibodies raised in rabbits against the peptides CEEPYGEIQISKGPNM and CYNPDDSVERMRDDPG (gene ID: RP1G00316120/RP2G00915110/RP4G01319620/RP5G01638170) and affinity-purified (Eurogentec). The anti-RpHEI10 was a combination of two antibodies raised in rabbits against the peptides CNRPNQSRARTNMFQL and CPVRQRNNKSMVSGGP (gene ID ...
-
bioRxiv - Microbiology 2023Quote: ... the anti-KhpB was generated with a synthesized peptide derived from C- terminus of KhpB protein (H-CGRDPKRYIVIKKKRG-OH) in rabbits (Eurogentec). The KhpB anti- serum was tested with ELISA assay and further cleaned with affinity purification ...
-
bioRxiv - Microbiology 2023Quote: Polyclonal antisera against ComG pilins were produced by immunising rabbits with a mixture of two different peptides that were synthesised from each protein (Eurogentec). Peptides corresponding to the following residues in mature pilins were used ...
-
bioRxiv - Molecular Biology 2024Quote: ... hepatica cathepsin L1 pro-peptide (rFhCL1pp; 1:500 dilution, non-related control) and pre-immune anti-rFhCL1pp (1:500 dilution) (Eurogentec). Parasite sections were incubated at RT for five hours in a humid container ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNA 2 5’ GCCCUAUCCCUUUACGUCA (Eurogentec). Dharmacon ONTarget plus SMARTpool ...
-
bioRxiv - Biochemistry 2021Quote: ... rabbits were immunised with a phosphorylated peptide H2N-DSPEVD(p)SKAALLPC-NH2 coupled via its C-terminal cysteine residue to keyhole limpet hemocyanin (Eurogentec, Belgium). The generated serum was subjected to two rounds of affinity chromatography ...
-
bioRxiv - Neuroscience 2023Quote: The polyclonal sPrPY226 antibody was generated (upon structural prediction of Y226 as a potential shedding site) using an anti-peptide approach following a standard 87-day polyclonal protocol (Eurogentec, Belgium). Briefly ...
-
bioRxiv - Microbiology 2019Quote: An MHC I class-restricted peptide from YFV-17D non-structural protein 3 (NS3) (sequence ATLTYRML) (57) was synthetized by Eurogentec (Seraing, Belgium). Total cellular antigen for YFV-17D and JEV SA14-14-2 was prepared first by infecting Vero E6 cells with 0.1 MOI YFV-17D or JEV SA14-14-2 ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibody staining was carried out at room temperature for 1 hour with custom made AOX antibodies (Eurogentec; Peptide: 1911009, Rabbit 237), diluted to 1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... TaqMan 2× Mastermix Plus – Low ROX (Eurogentec), and the related TaqMan assays together with 8 µl of the diluted DNA samples (n=3) ...
-
bioRxiv - Immunology 2022Quote: ... and TRAC or TRBC1/2 specific primers (Eurogentec) (see Supplementary file 5 for primer list) ...
-
bioRxiv - Cell Biology 2023Quote: ... and TaqMan 2× Mastermix Plus – Low ROX (Eurogentec) on a ViiA 7 thermocycler (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: DNA sequences (Table 2) were supplied by Eurogentec (Belgium), synthesized on a 1000 nmol scale and purified by reverse phase HPLC ...
-
bioRxiv - Genetics 2019Quote: ... The purified protein was used to immunize 2 rabbits (Eurogentec, Belgium), and the resulting immune antisera were tested against the recombinant antigen by ELISA (Eurogentec) ...
-
bioRxiv - Cell Biology 2023Quote: The anti-M6 antiserum #2 was generated by immunizing guinea pigs (Eurogentec) with the peptides GKGNNRDRIRDPRE and RRNSYRSDHSLDRYT (corresponding to aa 57–71 and 102–116 in M6 isoform F ...
-
bioRxiv - Biophysics 2019Quote: ... and Oregon Green 488 maleimide were purchased from LIFE TECHNOLOGIES LTD (Paisley, UK) and 6-bromoacetyl-2-dimethylaminonaphthalene (BADAN) from EUROGENTEC (Southampton, UK). N-(2-(iodoacetamido)ethyl)-7-diethylaminocoumarin-3-carboxamide (IDCC ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.3 mg of protein was used per rabbit for immunization of 2 rabbits (Eurogentec). Serum collected from one rabbit was affinity purified against GST-ATI11-180 ...
-
bioRxiv - Molecular Biology 2021Quote: ... using 2 μl of the diluted cDNAs (1:5) and Takyon Blue Master Mix (Eurogentec). All primers used are listed in Table S9 ...
-
bioRxiv - Neuroscience 2023Quote: ... Capture antibodies were: our previously described custom rabbit anti-(GR)7 antibody (Eurogentec 2 µg/mL) 90 ...
-
bioRxiv - Microbiology 2020Quote: ... or 500 ng to 3 µg for integrative plasmids (MicroPulserTM electroporator Biorad in 2 mm cuvettes (Eurogentec) at 25 µF ...
-
bioRxiv - Microbiology 2021Quote: ... and the products were run on a 2% agarose gel at 100 V for 30 mins alongside the 100-1000 bp DNA Ladder (SmartLadder-SF, Eurogentec).
-
bioRxiv - Biochemistry 2023Quote: ... C+IVAPGEARLGSIKMA for bGIC-1 and C+TAAEGRISGMAIAKS for bGIC-2) were generated as a N-terminal Keyhole limpet haemocyanin fusion to raise the antibodies in rabbits (Eurogentec). For Western blots ...
-
bioRxiv - Microbiology 2024Quote: An amount of 2 μL of cDNA was then used for quantitative PCR with the MESA GREEN qPCR MasterMix Plus (Eurogentec) and primers for AID (Forward 5′ AATTCAAAAATGTCCGCTGGGC*T3′ ...
-
bioRxiv - Cancer Biology 2024Quote: ... Metaphases were denatured at 72°C in 70% formamide/30% 2xSSC solution for 2 min before hybridization to Alexa 488–OO-(CCCTAA)n probe (Eurogentec) at 37°C for 16 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... Relative copy numbers of the single-copy nuclear-encoded gene beta-2-microglobulin (β2M) and the mitochondrially-encoded gene mtND1 were measured by quantitative (Q)-PCR using SYBR Green Mastermix (Eurogentec Ltd.) and the DNA Engine Opticon 2 system (BioRad) ...
-
bioRxiv - Immunology 2020Quote: ... The expression of the genes of hexokinase 2 (HK2) and LDH-A was determined using PCR SYBR Green sequence detection system (Eurogentec, Seraing, Belgium) and the CFX Connect™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Physiology 2019Quote: ... and each sample was run in triplicate with 2 µL of the diluted cDNA and 8 µL of master mix containing 1x qPCR MasterMix Plus Low ROX (Eurogentec, Liège, Belgium) or 1x TaqMan gene expression MasterMix (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... in a final volume of 10 µL (0.5 µL of each primer, 5 µL of Eurogentec Takyon™ SYBR® 2 x qPCR Mastermix Blue). The following Light-Cycler run protocol was used ...