Labshake search
Citations for Eurogentec :
51 - 100 of 128 citations for Rat Antigen peptide transporter 2 TAP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... The primary antibodies used in this study were raised in rabbit against a peptide sequence from the ZFD of RelA (Eurogentec). Next ...
-
bioRxiv - Genomics 2023Quote: ... The anti-RpHEI10 was a combination of two antibodies raised in rabbits against the peptides CNRPNQSRARTNMFQL and CPVRQRNNKSMVSGGP (gene ID: RP3G01271190/RP3G01008630/RP1G00269340/RP2G00699130) and affinity-purified (Eurogentec). Each primary antibody was diluted 1:200 in blocking solution ...
-
bioRxiv - Genomics 2023Quote: ... The anti-ZYP1 was raised in chickens against the peptide EGSLNPYADDPYAFD of the C-terminal end of AtZYP1a/b (gene ID: At1g22260/At1g22275) and affinity-purified (Eurogentec) (PAK048) ...
-
bioRxiv - Genomics 2023Quote: ... The anti-RpREC8 was a combination of two antibodies raised in rabbits against the peptides CEEPYGEIQISKGPNM and CYNPDDSVERMRDDPG (gene ID: RP1G00316120/RP2G00915110/RP4G01319620/RP5G01638170) and affinity-purified (Eurogentec). The anti-RpHEI10 was a combination of two antibodies raised in rabbits against the peptides CNRPNQSRARTNMFQL and CPVRQRNNKSMVSGGP (gene ID ...
-
bioRxiv - Microbiology 2023Quote: ... the anti-KhpB was generated with a synthesized peptide derived from C- terminus of KhpB protein (H-CGRDPKRYIVIKKKRG-OH) in rabbits (Eurogentec). The KhpB anti- serum was tested with ELISA assay and further cleaned with affinity purification ...
-
bioRxiv - Microbiology 2023Quote: Polyclonal antisera against ComG pilins were produced by immunising rabbits with a mixture of two different peptides that were synthesised from each protein (Eurogentec). Peptides corresponding to the following residues in mature pilins were used ...
-
bioRxiv - Molecular Biology 2024Quote: ... hepatica cathepsin L1 pro-peptide (rFhCL1pp; 1:500 dilution, non-related control) and pre-immune anti-rFhCL1pp (1:500 dilution) (Eurogentec). Parasite sections were incubated at RT for five hours in a humid container ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNA 2 5’ GCCCUAUCCCUUUACGUCA (Eurogentec). Dharmacon ONTarget plus SMARTpool ...
-
bioRxiv - Biochemistry 2021Quote: ... rabbits were immunised with a phosphorylated peptide H2N-DSPEVD(p)SKAALLPC-NH2 coupled via its C-terminal cysteine residue to keyhole limpet hemocyanin (Eurogentec, Belgium). The generated serum was subjected to two rounds of affinity chromatography ...
-
bioRxiv - Neuroscience 2023Quote: The polyclonal sPrPY226 antibody was generated (upon structural prediction of Y226 as a potential shedding site) using an anti-peptide approach following a standard 87-day polyclonal protocol (Eurogentec, Belgium). Briefly ...
-
bioRxiv - Microbiology 2019Quote: An MHC I class-restricted peptide from YFV-17D non-structural protein 3 (NS3) (sequence ATLTYRML) (57) was synthetized by Eurogentec (Seraing, Belgium). Total cellular antigen for YFV-17D and JEV SA14-14-2 was prepared first by infecting Vero E6 cells with 0.1 MOI YFV-17D or JEV SA14-14-2 ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibody staining was carried out at room temperature for 1 hour with custom made AOX antibodies (Eurogentec; Peptide: 1911009, Rabbit 237), diluted to 1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: ... or PLEKHA6 (RtSZR127, IB: 1/1000, IF,IHC: 1/100) were generated by immunization of rats (Polyclonal Antibody Production, Eurogentec) with purified N-terminally GST- fused C-terminal fragments of human PLEKHA5 (NP_061885 ...
-
bioRxiv - Biochemistry 2021Quote: Localization studies were carried out using a rat antibody raised against purified recombinant Pf-int (aa 192-490) (Eurogentec, Belgium). Fixed parasites were spotted in each well of the microscopy slide and air-dried at RT in order to allow the parasites to adhere ...
-
bioRxiv - Cell Biology 2023Quote: ... TaqMan 2× Mastermix Plus – Low ROX (Eurogentec), and the related TaqMan assays together with 8 µl of the diluted DNA samples (n=3) ...
-
bioRxiv - Biochemistry 2021Quote: Western blot analyses were carried out using a rat antibody raised against purified recombinant Pf-int (aa 192-490) (Eurogentec, Belgium). The protein content was transferred to a nitrocellulose membrane using the Trans Blot Turbo (BioRad ...
-
bioRxiv - Immunology 2022Quote: ... and TRAC or TRBC1/2 specific primers (Eurogentec) (see Supplementary file 5 for primer list) ...
-
bioRxiv - Cell Biology 2023Quote: ... and TaqMan 2× Mastermix Plus – Low ROX (Eurogentec) on a ViiA 7 thermocycler (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: DNA sequences (Table 2) were supplied by Eurogentec (Belgium), synthesized on a 1000 nmol scale and purified by reverse phase HPLC ...
-
bioRxiv - Genetics 2019Quote: ... The purified protein was used to immunize 2 rabbits (Eurogentec, Belgium), and the resulting immune antisera were tested against the recombinant antigen by ELISA (Eurogentec) ...
-
bioRxiv - Cell Biology 2023Quote: The anti-M6 antiserum #2 was generated by immunizing guinea pigs (Eurogentec) with the peptides GKGNNRDRIRDPRE and RRNSYRSDHSLDRYT (corresponding to aa 57–71 and 102–116 in M6 isoform F ...
-
bioRxiv - Biophysics 2019Quote: ... and Oregon Green 488 maleimide were purchased from LIFE TECHNOLOGIES LTD (Paisley, UK) and 6-bromoacetyl-2-dimethylaminonaphthalene (BADAN) from EUROGENTEC (Southampton, UK). N-(2-(iodoacetamido)ethyl)-7-diethylaminocoumarin-3-carboxamide (IDCC ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.3 mg of protein was used per rabbit for immunization of 2 rabbits (Eurogentec). Serum collected from one rabbit was affinity purified against GST-ATI11-180 ...
-
bioRxiv - Molecular Biology 2021Quote: ... using 2 μl of the diluted cDNAs (1:5) and Takyon Blue Master Mix (Eurogentec). All primers used are listed in Table S9 ...
-
bioRxiv - Molecular Biology 2021Quote: ... random nonamers (Eurogentec Reverse Transcriptase Core Kit) was used to prepare cDNA by using the 200 ng of the total RNA for 10 μl of reaction and the produced cDNA was used for comparative quantitation of mRNA expression ...
-
bioRxiv - Cell Biology 2020Quote: A PLA kit II (Eurogentec, Seraing, BE) was used according to the manufacturer’s instructions with slight modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... Capture antibodies were: our previously described custom rabbit anti-(GR)7 antibody (Eurogentec 2 µg/mL) 90 ...
-
bioRxiv - Molecular Biology 2020Quote: ... mRNA real time quantification was generally performed in a two step format using Eurogentec Reverse Transcriptase Core Kit and MESA GREEN qPCR Master Mix Plus for SYBR Assay with Low Rox kit from Eurogentec following the suppliers’ protocols ...
-
bioRxiv - Cancer Biology 2021Quote: ... mRNA real time quantification was generally performed in a two step format using Eurogentec Reverse Transcriptase Core Kit and MESA GREEN qPCR Master Mix Plus for SYBR Assay with Low Rox kit from Eurogentec following the suppliers’ protocols ...
-
bioRxiv - Microbiology 2020Quote: ... or 500 ng to 3 µg for integrative plasmids (MicroPulserTM electroporator Biorad in 2 mm cuvettes (Eurogentec) at 25 µF ...
-
bioRxiv - Plant Biology 2020Quote: ... For qPCR a SYBR Green core qPCR kit (Eurogentec) and a StepOnePlus machine (ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... using MESA BLUE qPCR kit for SYBR assay (Eurogentec) according to the manufacturer’s instructions with primers for 18S (see Table 1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using the SYBR Green I qPCR core kit (Eurogentec). Thermal conditions were 50°C for 2 minutes ...
-
bioRxiv - Plant Biology 2020Quote: ... We used Takyon qPCR Kit for SYBER assay (Eurogentec) and the RT-PCR was carried out in CFX96 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... using MESA BLUE qPCR kit for SYBR assay (Eurogentec) according to the manufacturer’s instructions with primers for 18S (see Table 1 ...
-
bioRxiv - Genetics 2023Quote: ... and then a Takyon SYBR Green PCR kit (Eurogentec) in a StepOnePlus apparatus (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... Takyon ROX SYBR Master Mix blue dTTP Kit (Eurogentec) was used ...
-
bioRxiv - Pathology 2021Quote: ... Reverse transcription was performed using Reverse Transcriptase Core Kit (Eurogentec). qRT-PCR were performed on a LightCycler 480 instrument (Roche ...
-
bioRxiv - Plant Biology 2022Quote: ... 30 s) using Takyon qPCR kit for SYBR assay (Eurogentec) (2.5 µL TAKYON SYBER 2X ...
-
bioRxiv - Physiology 2024Quote: ... and reverse transcribed with the Reverse Transcriptase Core kit (Eurogentec). Gene expression was analyzed by quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Microbiology 2021Quote: ... and the products were run on a 2% agarose gel at 100 V for 30 mins alongside the 100-1000 bp DNA Ladder (SmartLadder-SF, Eurogentec).
-
bioRxiv - Biochemistry 2023Quote: ... C+IVAPGEARLGSIKMA for bGIC-1 and C+TAAEGRISGMAIAKS for bGIC-2) were generated as a N-terminal Keyhole limpet haemocyanin fusion to raise the antibodies in rabbits (Eurogentec). For Western blots ...
-
bioRxiv - Microbiology 2024Quote: An amount of 2 μL of cDNA was then used for quantitative PCR with the MESA GREEN qPCR MasterMix Plus (Eurogentec) and primers for AID (Forward 5′ AATTCAAAAATGTCCGCTGGGC*T3′ ...
-
bioRxiv - Cancer Biology 2024Quote: ... Metaphases were denatured at 72°C in 70% formamide/30% 2xSSC solution for 2 min before hybridization to Alexa 488–OO-(CCCTAA)n probe (Eurogentec) at 37°C for 16 hours ...
-
bioRxiv - Systems Biology 2021Quote: ... mRNA was reverse transcribed using the Reverse Transcriptase Core kit (Eurogentec). In order to reduce variability in mRNA input ...
-
bioRxiv - Immunology 2021Quote: ... the kit Takyon No ROX SYBR 2X MasterMix blue dTTP (Eurogentec) and the LightCycler480II (Roche Diagnostics ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription was carried out with a reverse transcriptase kit (Eurogentec). Quantitative real-time PCR was performed using a Bio-Rad CFX (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2019Quote: ... Relative copy numbers of the single-copy nuclear-encoded gene beta-2-microglobulin (β2M) and the mitochondrially-encoded gene mtND1 were measured by quantitative (Q)-PCR using SYBR Green Mastermix (Eurogentec Ltd.) and the DNA Engine Opticon 2 system (BioRad) ...
-
bioRxiv - Cancer Biology 2020Quote: All reactions were performed with the qPCR Core Kit (Eurogentec, Seraing, Belgium) in a total reaction volume of 10 μl in 384-well plates ...
-
bioRxiv - Microbiology 2019Quote: ... using the Mesa Blue qPCR Mastermix Plus for Sybr assay kit (Eurogentec). Each reaction was performed in triplicate on three separate occasions ...