Labshake search
Citations for Eurogentec :
1 - 50 of 85 citations for Mouse anti Plasmodium vivax MSP1 PVM 2 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: Anti-TRPM7 2C7 mouse monoclonal antibody (anti-M7d, Figure 1-figure supplement 1) was produced by Eurogentec (Belgium) as follows ...
-
bioRxiv - Cell Biology 2023Quote: The anti-M6 antiserum #2 was generated by immunizing guinea pigs (Eurogentec) with the peptides GKGNNRDRIRDPRE and RRNSYRSDHSLDRYT (corresponding to aa 57–71 and 102–116 in M6 isoform F ...
-
bioRxiv - Neuroscience 2023Quote: ... Capture antibodies were: our previously described custom rabbit anti-(GR)7 antibody (Eurogentec 2 µg/mL) 90 ...
-
bioRxiv - Genomics 2020Quote: ... 1.25 µl of mouse anti-human 5mC antibody (clone 33D3; Eurogentec Ltd., Cat No. BI-MECY, RRID:AB_2616058), and 10 µl of Dynabeads coupled with M-280 sheep anti-mouse IgG bead (Invitrogen) ...
-
bioRxiv - Genomics 2019Quote: ... 0.05% Triton X-100) using 1 µl of mouse monoclonal anti-5-methylcytosine antibody (Eurogentec BI-MECY-0100) or 0,5 µl of rabbit 5-Hydroxymethylcytosine antibody (Active motif 39769) ...
-
bioRxiv - Cell Biology 2021Quote: ... and washed with PBS before blocking and primary antibody incubation (mouse-anti 5-methycytosine, Eurogentec, BI-MECY-0100, 1:250). After PBS washes ...
-
bioRxiv - Plant Biology 2022Quote: ... SCOOP10#2* (GDIFTGPSGSGHGGGRTPAP) corresponding to SCOOP10#2 without hydroxyprolines was obtained from Eurogentec SA (Seraing ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNA 2 5’ GCCCUAUCCCUUUACGUCA (Eurogentec). Dharmacon ONTarget plus SMARTpool ...
-
bioRxiv - Cell Biology 2023Quote: ... TaqMan 2× Mastermix Plus – Low ROX (Eurogentec), and the related TaqMan assays together with 8 µl of the diluted DNA samples (n=3) ...
-
bioRxiv - Immunology 2021Quote: Immunising and screening peptides are outlined in S.Table 2 (Figure 3-figure supplement 2) and were synthesized by Eurogentec (Belgium). A portion was further conjugated to Key Lymphocyte Haemoglutinin (KLH ...
-
bioRxiv - Immunology 2022Quote: ... and TRAC or TRBC1/2 specific primers (Eurogentec) (see Supplementary file 5 for primer list) ...
-
bioRxiv - Cell Biology 2023Quote: ... and TaqMan 2× Mastermix Plus – Low ROX (Eurogentec) on a ViiA 7 thermocycler (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-DnaD and anti- DnaB antibodies (Eurogentec) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-DnaD and anti-DnaB antibodies (Eurogentec) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: DNA sequences (Table 2) were supplied by Eurogentec (Belgium), synthesized on a 1000 nmol scale and purified by reverse phase HPLC ...
-
bioRxiv - Plant Biology 2023Quote: Biotinylated peptides (synthetized by Eurogentec, sequences shown in Fig. 2) were mostly insoluble in water and were thus resuspended in 6 M urea ...
-
bioRxiv - Genetics 2019Quote: ... The purified protein was used to immunize 2 rabbits (Eurogentec, Belgium), and the resulting immune antisera were tested against the recombinant antigen by ELISA (Eurogentec) ...
-
bioRxiv - Biophysics 2019Quote: ... and Oregon Green 488 maleimide were purchased from LIFE TECHNOLOGIES LTD (Paisley, UK) and 6-bromoacetyl-2-dimethylaminonaphthalene (BADAN) from EUROGENTEC (Southampton, UK). N-(2-(iodoacetamido)ethyl)-7-diethylaminocoumarin-3-carboxamide (IDCC ...
-
bioRxiv - Neuroscience 2023Quote: ... Guinea pig anti-EAAT5b and rabbit anti-EAAT7 antibodies were column purified by Eurogentec.
-
bioRxiv - Cell Biology 2023Quote: ... Custom rabbit pAb anti-pS62 and anti-pT61-pS62 NDC80 were raised by Eurogentec using a 28-day protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... anti-BBX22(199–213) (Eurogentec, raised in rabbits against the peptide C+DQSYEYMENNGSSKT and affinity purified) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.3 mg of protein was used per rabbit for immunization of 2 rabbits (Eurogentec). Serum collected from one rabbit was affinity purified against GST-ATI11-180 ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-rabbit Six3 (1:10,000, Eurogentec custom antibody ...
-
bioRxiv - Molecular Biology 2021Quote: ... using 2 μl of the diluted cDNAs (1:5) and Takyon Blue Master Mix (Eurogentec). All primers used are listed in Table S9 ...
-
bioRxiv - Genomics 2022Quote: Antibodies against H2A.Z.11 (KGLVAAKTMAANKDKC) and H2A.2 (CPKKAGSSKPTEED) peptides were raised in rabbits (Eurogentec) and purified by peptide affinity column ...
-
bioRxiv - Genomics 2023Quote: Antibodies against H2A.Z.11 (KGLVAAKTMAANKDKC) and H2A.2 (CPKKAGSSKPTEED) peptides were raised in rabbits (Eurogentec) and purified by a peptide affinity column ...
-
bioRxiv - Microbiology 2023Quote: ... anti-ΦKZ014.2 (1661, rabbit, 1:10k, Eurogentec, produced against peptide TEYDRNHGWNIREKH ...
-
bioRxiv - Microbiology 2023Quote: ... anti-ΦKZ014.1 (1660, rabbit, 1:10k, Eurogentec, produced against peptide EQYGESDDTSDESSY ...
-
bioRxiv - Microbiology 2019Quote: ... Anti-OmpA antibody54 was used at 1:20,000 and a custom anti-TssL antibody (Eurogentec; see Supplementary Fig. 8) was used at 1:6,000 ...
-
bioRxiv - Microbiology 2020Quote: ... or 500 ng to 3 µg for integrative plasmids (MicroPulserTM electroporator Biorad in 2 mm cuvettes (Eurogentec) at 25 µF ...
-
bioRxiv - Neuroscience 2019Quote: ... Tibialis anterior muscles were dissected into bundles and processed for immunofluorescence using a combination of rabbit anti-synaptophysin and rabbit anti-neurofilament antibodies (Eurogentec) followed by an Alexa-conjugated donkey anti-rabbit 488 (Jackson ...
-
bioRxiv - Cell Biology 2021Quote: ... 2Y4824 rabbit anti-pre-immune serum (PIS; Eurogentec) was used for control purposes ...
-
bioRxiv - Neuroscience 2020Quote: ... and rabbit anti-neurofilament antibodies (Eurogentec, 1/50) followed by an Alexa-conjugated donkey anti-rabbit 488 (Jackson ...
-
bioRxiv - Molecular Biology 2022Quote: ... because detection via our anti-DnaD antibody (Eurogentec) was not fully consistent between wild-type and variant alleles of dnaD ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1.25μg anti-5mC antibody (Eurogentec BI-MECY-0100) and 10μL Dynabeads coupled with M-280 sheep anti-mouse antibody (Invitrogen) ...
-
bioRxiv - Biochemistry 2023Quote: ... Guinea pig anti-TPI-GAPDH (1:1000; Eurogentec), previously shown to localise in the mitochondria (Bártulos etLJal. ...
-
A quantitative tri-fluorescent yeast two-hybrid system: from flow cytometry to in-cellula affinitiesbioRxiv - Biochemistry 2019Quote: ... HA tagged proteins were labeled overnight at 4°C with the mouse HA.11 Clone 16B12 Monoclonal Antibody (Eurogentec) 1/2000 in PBS + tween 0.2% (v/v ...
-
bioRxiv - Physiology 2023Quote: MMP2 and 9 activity assays were used to measure MMP2 and 9 activities in frozen mouse heart tissue and plasma following the manufacturer’s instructions (AS-72017, Eurogentec). MMP9 activity in conditioned media from human ciCMVEC was also assessed.
-
bioRxiv - Microbiology 2019Quote: ... Polyclonal Anti-Rv3852 antibody was produced by Eurogentec (30).
-
bioRxiv - Plant Biology 2019Quote: ... Anti-5-methylcytosine (Eurogentec BI-MECY-0100, lot: vt150601) or anti-H3K9me2 (Abcam ab1220 ...
-
bioRxiv - Neuroscience 2019Quote: Primary antibodies: anti-CNK2 (guinea pig, Eurogentec, custom-made), anti-CNK2 (rabbit ...
-
bioRxiv - Developmental Biology 2021Quote: Polyclonal anti Am TIG1 antibodies were manufactured by Eurogentec, by raising rabbit antisera against two non-overlapping peptides corresponding to residues MAQVKSVKQRLRND (154 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-FPN antibody (1:2,000, Eurogentec, NRU 451443), rabbit anti-FTH (1:500 ...
-
bioRxiv - Microbiology 2021Quote: ... and the products were run on a 2% agarose gel at 100 V for 30 mins alongside the 100-1000 bp DNA Ladder (SmartLadder-SF, Eurogentec).
-
bioRxiv - Biochemistry 2023Quote: ... C+IVAPGEARLGSIKMA for bGIC-1 and C+TAAEGRISGMAIAKS for bGIC-2) were generated as a N-terminal Keyhole limpet haemocyanin fusion to raise the antibodies in rabbits (Eurogentec). For Western blots ...
-
bioRxiv - Microbiology 2024Quote: An amount of 2 μL of cDNA was then used for quantitative PCR with the MESA GREEN qPCR MasterMix Plus (Eurogentec) and primers for AID (Forward 5′ AATTCAAAAATGTCCGCTGGGC*T3′ ...
-
bioRxiv - Cancer Biology 2024Quote: ... Metaphases were denatured at 72°C in 70% formamide/30% 2xSSC solution for 2 min before hybridization to Alexa 488–OO-(CCCTAA)n probe (Eurogentec) at 37°C for 16 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... N2A polyclonal anti-rabbit (custom-made by Eurogentec, Seraing, Belgium), PEVK polyclonal anti-rabbit (Myomedix ...
-
bioRxiv - Cell Biology 2020Quote: Anti-TMEM70 antibodies were rabbit polyclonal sera raised by Eurogentec SA (Belgium ...
-
bioRxiv - Neuroscience 2022Quote: ... Rabbit anti-Mmt (Eurogentec, generated in this study, see below); and Mouse anti-NC82 (nc82 was deposited to the DSHB by Buchner ...