Labshake search
Citations for Eurogentec :
101 - 150 of 155 citations for Mouse anti Plasmodium falciparum HRP 2 antibody M482 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 2Y4824 rabbit anti-pre-immune serum (PIS; Eurogentec) was used for control purposes ...
-
bioRxiv - Biochemistry 2023Quote: ... Guinea pig anti-TPI-GAPDH (1:1000; Eurogentec), previously shown to localise in the mitochondria (Bártulos etLJal. ...
-
bioRxiv - Physiology 2023Quote: MMP2 and 9 activity assays were used to measure MMP2 and 9 activities in frozen mouse heart tissue and plasma following the manufacturer’s instructions (AS-72017, Eurogentec). MMP9 activity in conditioned media from human ciCMVEC was also assessed.
-
bioRxiv - Plant Biology 2020Quote: ... WOX9 peptide antibodies used for ChIP assays were synthesized by Eurogentec (https://www.eurogentec.com/en/) using amino acid sequences specific for SRB homolog Phvul.006G179900 and SB homolog Glyma.11G210800 (Fig ...
-
bioRxiv - Neuroscience 2023Quote: Zebrafish peptide specific antibodies were generated in an 87-day classical program by Eurogentec S.A ...
-
bioRxiv - Plant Biology 2019Quote: ... Anti-5-methylcytosine (Eurogentec BI-MECY-0100, lot: vt150601) or anti-H3K9me2 (Abcam ab1220 ...
-
bioRxiv - Biochemistry 2024Quote: The expression and cellular localization of BT4244 M60L was determined using rabbit polyclonal antibodies (Eurogentec) generated against a purified recombinant version of the protein lacking the lipoprotein signal sequence ...
-
bioRxiv - Microbiology 2021Quote: ... and the products were run on a 2% agarose gel at 100 V for 30 mins alongside the 100-1000 bp DNA Ladder (SmartLadder-SF, Eurogentec).
-
bioRxiv - Microbiology 2024Quote: An amount of 2 μL of cDNA was then used for quantitative PCR with the MESA GREEN qPCR MasterMix Plus (Eurogentec) and primers for AID (Forward 5′ AATTCAAAAATGTCCGCTGGGC*T3′ ...
-
bioRxiv - Cancer Biology 2024Quote: ... Metaphases were denatured at 72°C in 70% formamide/30% 2xSSC solution for 2 min before hybridization to Alexa 488–OO-(CCCTAA)n probe (Eurogentec) at 37°C for 16 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... N2A polyclonal anti-rabbit (custom-made by Eurogentec, Seraing, Belgium), PEVK polyclonal anti-rabbit (Myomedix ...
-
bioRxiv - Neuroscience 2022Quote: ... Rabbit anti-Mmt (Eurogentec, generated in this study, see below); and Mouse anti-NC82 (nc82 was deposited to the DSHB by Buchner ...
-
bioRxiv - Cell Biology 2021Quote: The polyclonal rabbit phospho-ACBD5 Ser269 antibody (α-ACBD5 pS269) was produced by Eurogentec (Seraing, Belgium). The antibody was raised against peptide 264EVYCDSMEQFGQE276 including a phospho-Ser269 ...
-
bioRxiv - Microbiology 2022Quote: ... 0.8 mg protein was used for raising two antibodies against KhpB in rabbit (Eurogentec, speedy program).
-
bioRxiv - Microbiology 2023Quote: Antibodies against BacA were raised by immunization of rabbits with purified BacA-His6 protein (Eurogentec, Belgium). Cells were harvested in the exponential growth phase ...
-
bioRxiv - Cell Biology 2019Quote: ... Relative copy numbers of the single-copy nuclear-encoded gene beta-2-microglobulin (β2M) and the mitochondrially-encoded gene mtND1 were measured by quantitative (Q)-PCR using SYBR Green Mastermix (Eurogentec Ltd.) and the DNA Engine Opticon 2 system (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... The anti-M6 antiserum was generated by immunizing guinea pigs (Eurogentec) with the peptides RRNSYRSDHSLDRYT and NLNELEYSATSKDRF (corresponding to aa 102-116 and 354-368 in M6 isoform F ...
-
bioRxiv - Plant Biology 2019Quote: ... NAR2.1 was detected using one anti-NAR2.1 antisera produced by Eurogentec against the synthetic peptide DVTTKPSREGPGVVL (anti-NAR2.1) ...
-
bioRxiv - Immunology 2020Quote: ... The expression of the genes of hexokinase 2 (HK2) and LDH-A was determined using PCR SYBR Green sequence detection system (Eurogentec, Seraing, Belgium) and the CFX Connect™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Physiology 2019Quote: ... and each sample was run in triplicate with 2 µL of the diluted cDNA and 8 µL of master mix containing 1x qPCR MasterMix Plus Low ROX (Eurogentec, Liège, Belgium) or 1x TaqMan gene expression MasterMix (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... A guinea pig antibody was then raised against the purified peptide by Eurogentec (Kaneka Eurogentec S.A., Belgium). Finally ...
-
bioRxiv - Plant Biology 2019Quote: ... NRT2.1 was detected using three different anti-NRT2.1 antisera produced by Eurogentec against either the synthetic peptide TLEKAGEVAKDKFGK (anti-NRT2.1 19) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Rabbit anti-AscA antiserum was produced using purified AscA by Eurogentec (Liège, Belgium). Rabbit anti-OmpF antiserum was a kind gift from T ...
-
bioRxiv - Molecular Biology 2020Quote: ... indirect immunofluorescence was performed using a custom generated polyclonal antibody raised against the ODA holocomplex (Eurogentec, 1:150 dilution) and an acetylated α-tubulin antibody (SantaCruz ...
-
bioRxiv - Plant Biology 2022Quote: ... The antibody against PsaA was raised using the following peptides STPEREAKKVKIAVDR and VKIAVDRNPVETSFEK and was obtained from Eurogentec (Belgium). Secondary antibodies for ECL detection were anti-rabbit (Invitrogen).
-
bioRxiv - Genomics 2021Quote: ... in a final volume of 10 µL (0.5 µL of each primer, 5 µL of Eurogentec Takyon™ SYBR® 2 x qPCR Mastermix Blue). The following Light-Cycler run protocol was used ...
-
bioRxiv - Plant Biology 2021Quote: ... and polyclonal antibodies raised against phosphorylated S744 of NPH3 using peptide KPRRWRNpSIS (where pS represents phosphorylated serine) as antigen (Eurogentec). Blots were developed with horseradish peroxidase (HRP)-linked secondary antibodies (Promega ...
-
bioRxiv - Cell Biology 2021Quote: ... were digested with Prescission protease (Amersham Pharmacia Biotech) and used to produce monoclonal antibodies as described42 and to raise polyclonal rabbit antiserum #4457 (Eurogentec). The NHSL1 monoclonal antibody was subcloned twice (clone C286F5E1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The primary antibodies used in this study were raised in rabbit against a peptide sequence from the ZFD of RelA (Eurogentec). Next ...
-
bioRxiv - Cell Biology 2021Quote: ... or PLEKHA6 (RtSZR127, IB: 1/1000, IF,IHC: 1/100) were generated by immunization of rats (Polyclonal Antibody Production, Eurogentec) with purified N-terminally GST- fused C-terminal fragments of human PLEKHA5 (NP_061885 ...
-
bioRxiv - Biochemistry 2021Quote: Localization studies were carried out using a rat antibody raised against purified recombinant Pf-int (aa 192-490) (Eurogentec, Belgium). Fixed parasites were spotted in each well of the microscopy slide and air-dried at RT in order to allow the parasites to adhere ...
-
bioRxiv - Cell Biology 2023Quote: Crb3 homeolog L and S specific antibodies were obtained by immunizing rabbits using the speedy protocol from Eurogentec (Seraing, Belgium). The synthetic peptides identical to the ectodomain of Crb3.L (H-QNVTTSAPDRLSESAR-C ...
-
bioRxiv - Genomics 2023Quote: ... The anti-RpHEI10 was a combination of two antibodies raised in rabbits against the peptides CNRPNQSRARTNMFQL and CPVRQRNNKSMVSGGP (gene ID: RP3G01271190/RP3G01008630/RP1G00269340/RP2G00699130) and affinity-purified (Eurogentec). Each primary antibody was diluted 1:200 in blocking solution ...
-
bioRxiv - Genomics 2023Quote: ... The anti-RpREC8 was a combination of two antibodies raised in rabbits against the peptides CEEPYGEIQISKGPNM and CYNPDDSVERMRDDPG (gene ID: RP1G00316120/RP2G00915110/RP4G01319620/RP5G01638170) and affinity-purified (Eurogentec). The anti-RpHEI10 was a combination of two antibodies raised in rabbits against the peptides CNRPNQSRARTNMFQL and CPVRQRNNKSMVSGGP (gene ID ...
-
bioRxiv - Microbiology 2023Quote: ... Protein samples were analyzed by SDS-PAGE to determine purity prior to their use for immunization in rabbits for the generation of an affinity purified polyclonal antibody (Eurogentec).
-
bioRxiv - Microbiology 2023Quote: ... recombinantly produced EF-P was purified and sent to Eurogentec for polyclonal antibody generation (Speedy 28-day program in rabbits, Eurogentec). The blood serum containing antibodies against the R ...
-
bioRxiv - Microbiology 2020Quote: ... polyclonal rabbit anti-aa40-59 JCPyV agno-sera (generated on request by Eurogentec, Belgium), polyconal anti-BKPyV agnosera (generous gift from C ...
-
bioRxiv - Developmental Biology 2020Quote: DILP2 peptide corresponding to the sequence TRQRQGIVERC (amino acids 108-118) was used as an immunogen to raise DILP2 polyclonal antibody in rabbit (Eurogentec, Belgium). Mouse anti-GFP (Cat ...
-
bioRxiv - Plant Biology 2021Quote: A solution containing 3.5 mg of purified recombinant LbGH28A protein was used to elicit the production of polyclonal antibodies in rabbit according to the manufacturer’s procedure (Eurogentec, Seraing, Belgium). The indirect immunofluorescent (IIF ...
-
bioRxiv - Neuroscience 2021Quote: ... Purified GST tagged TMEM184B peptides TMEM184B 1-67 and TMEM184B 393-486 in equal proportions (1:1) were injected into rabbits using the Eurogentec Polyclonal Antibody Production service (Eurogentec, Belgium) using an 87 day protocol ...
-
bioRxiv - Biochemistry 2021Quote: Western blot analyses were carried out using a rat antibody raised against purified recombinant Pf-int (aa 192-490) (Eurogentec, Belgium). The protein content was transferred to a nitrocellulose membrane using the Trans Blot Turbo (BioRad ...
-
bioRxiv - Microbiology 2022Quote: ... The proteins were transferred on a nitrocellulose membrane and BfrG was detected by immunoblotting using a polyclonal antibody produced in guinea pig (Eurogentec, Belgium) at a 1:2,500 dilution ...
-
bioRxiv - Microbiology 2022Quote: ... negevensis [62,63] and antibodies targeting NlpC of each bacterium (produced by immunization of mice with the purified proteins, Eurogentec, Seraing, Belgium). A subsequent incubation with secondary antibodies Alexa Fluor 488 goat anti-mouse and Alexa Fluor 594 donkey anti-rabbit (Thermo FisherScientific ...
-
bioRxiv - Molecular Biology 2024Quote: A poly(GP) Meso Scale Discovery (MSD®) enzyme-linked immunosorbent assay (ELISA) was established using a custom made rabbit αLGP antibody (Eurogentec) and based on previously described methods16 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plates were washed again in TBS-T and 50 μl MSD® SULFO-TAG labelled streptavidin (1 μg ml-1) and biotinylated poly(GP) antibody (1 μg ml-1, Eurogentec) added per well diluted in blocking solution ...
-
bioRxiv - Microbiology 2020Quote: ... polyclonal rabbit anti-aa40-53 BKPyV agno-sera (generated on request by Eurogentec, clone 1163), polyclonal rabbit anti-BKPyV LTag sera (generous gift from C ...
-
bioRxiv - Microbiology 2023Quote: ... Native ΦKZ014 in infected cells was detected by Western blot (1:10k anti-ΦKZ014, Eurogentec, #1661 ...
-
bioRxiv - Microbiology 2022Quote: ... The proteins were injected into rabbits to generate polyclonal antibodies according to standard protocols (His-GspD, Cocalico, Reamstown, PA; His-PilQOlut, Eurogentec, Seraing, BE). Sera were tested for cross-reactivity by immunoblotting lysates from wildtype M ...
-
bioRxiv - Molecular Biology 2020Quote: ... immunostaining Q22YU3Δ/SHULINΔ cells with a custom polyclonal anti-body against Shulin (Eurogentec, 1:100 dilution) confirmed loss of protein as well as serving as antibody validation (Figure S12C ...
-
bioRxiv - Microbiology 2020Quote: ... polyclonal rabbit anti-aa52-66 BKPyV agno-sera (generated on request by Eurogentec, Belgium, clone 753), polyclonal rabbit anti-aa40-53 BKPyV agno-sera (generated on request by Eurogentec ...