Labshake search
Citations for Eurogentec :
1 - 50 of 124 citations for Mouse IgG1 Isotype Control Antibody 15H6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Control cells were electroporated with a scramble siRNA (siRNA-negative control duplex; Eurogentec).
-
bioRxiv - Cell Biology 2021Quote: ... control siRNA (Eurogentec, SR-CL000-005); for human SphK2 5’ GCUGGGCUGUCCUUCAACCU 3’ ...
-
bioRxiv - Cell Biology 2019Quote: ... For Control: Scrambled siRNA (Eurogentec SR-NP001-001) or siGENOME Non-Targeting Pool #1 (Dharmacon ...
-
bioRxiv - Cell Biology 2022Quote: ... Targeting and control siRNAs were synthesized by Eurogentec, Belgium ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cyp1b1 or a negative control siRNA (Eurogentec, Belgium) were done using Lipofectamine RNAiMAX reagent (Life Technologies ...
-
bioRxiv - Genomics 2020Quote: ... 1.25 µl of mouse anti-human 5mC antibody (clone 33D3; Eurogentec Ltd., Cat No. BI-MECY, RRID:AB_2616058), and 10 µl of Dynabeads coupled with M-280 sheep anti-mouse IgG bead (Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... hGBF1 (5’- CCUCUGUCAACAAGUUCCU-3’) and control siRNA was purchased from Eurogentec. Following plasmids used in this study were described previously ...
-
bioRxiv - Genomics 2019Quote: ... 0.05% Triton X-100) using 1 µl of mouse monoclonal anti-5-methylcytosine antibody (Eurogentec BI-MECY-0100) or 0,5 µl of rabbit 5-Hydroxymethylcytosine antibody (Active motif 39769) ...
-
bioRxiv - Biochemistry 2021Quote: Anti-TRPM7 2C7 mouse monoclonal antibody (anti-M7d, Figure 1-figure supplement 1) was produced by Eurogentec (Belgium) as follows ...
-
A quantitative tri-fluorescent yeast two-hybrid system: from flow cytometry to in-cellula affinitiesbioRxiv - Biochemistry 2019Quote: ... HA tagged proteins were labeled overnight at 4°C with the mouse HA.11 Clone 16B12 Monoclonal Antibody (Eurogentec) 1/2000 in PBS + tween 0.2% (v/v ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5μl of 10pmoles/μl of internal control forward primer (MS2) (supplied by Eurogentec), 0.5μl of 10pmoles/μl internal control reverse primer (MS2) ...
-
bioRxiv - Biophysics 2023Quote: ... cavin-1/PTRF (L-012807-02-0005) or control RNAi SR-CL000 (Eurogentec) was used at 100 nM via magnetofection technology (OZ Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... and washed with PBS before blocking and primary antibody incubation (mouse-anti 5-methycytosine, Eurogentec, BI-MECY-0100, 1:250). After PBS washes ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 15 Synthetic S100 and control peptides were custom-made by commercial suppliers (Eurogentec, GeneScript and Bachem) and sequences are given in Figure 1A ...
-
bioRxiv - Developmental Biology 2020Quote: ... Non-targeting control siRNA and siRNA duplexes targeting Sorbs1 (5’-UUAAGUCCUGAGUGCUCUUC-3’) were synthesized and purchased from Eurogentec.
-
bioRxiv - Immunology 2022Quote: ... were purchased from Dharmacon or Wnt5a siRNA (Cat no.-SR-NP001-001) and control siRNA (Cat no.-SR-CL000-005) were purchased from Eurogentec. cDNA synthesis kit (Cat no.-BB-E0045 ...
-
bioRxiv - Genetics 2020Quote: ... and random probe (negative control) were adapted from Chu et al.’s paper 18 (sequences in “Supplementary file”) and manufactured by Eurogentec. The method is summarised as follows ...
-
bioRxiv - Molecular Biology 2024Quote: ... hepatica cathepsin L1 pro-peptide (rFhCL1pp; 1:500 dilution, non-related control) and pre-immune anti-rFhCL1pp (1:500 dilution) (Eurogentec). Parasite sections were incubated at RT for five hours in a humid container ...
-
bioRxiv - Developmental Biology 2022Quote: ... Purified protein was shipped for antibody production (custom polyclonal antibodies, Eurogentec). Rabbit polyclonal anti-Shp1 was purified in house by affinity purification ...
-
bioRxiv - Molecular Biology 2020Quote: Custom-made antibodies (Eurogentec) against endogenous PIWI proteins were generated by immunization of two rabbits per antibody with a mix of two unique peptides (Ago3 ...
-
bioRxiv - Genomics 2024Quote: ... filiformis ParB antibody (Eurogentec) with a 1:1000 dilution ...
-
bioRxiv - Genomics 2024Quote: ... oneisti ParB antibody (Eurogentec). All primary antibodies were incubated in blocking solution overnight at 4°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antibodies were purchased from Eurogentec. Plasmid extractions were performed using Qiagen miniprep kits ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antibodies were purchased from Eurogentec. Plasmid extractions were performed using Qiagen miniprep kits ...
-
bioRxiv - Neuroscience 2023Quote: ... Capture antibodies were: our previously described custom rabbit anti-(GR)7 antibody (Eurogentec 2 µg/mL) 90 ...
-
bioRxiv - Cancer Biology 2019Quote: ... KLK4/KLKP1 (Eurogentec custom synthesized antibody) and β-actin (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... capture and detection antibody was the same affinity-purified custom anti-(GP)8 antibody (Eurogentec, biotinylated for detector). For polyGA ...
-
bioRxiv - Microbiology 2021Quote: ... Antibodies against TfcP were generated by Eurogentec against TfcPΔ1-18-His6 purified from E ...
-
bioRxiv - Cell Biology 2020Quote: ... All antibodies were custom made by Eurogentec.
-
bioRxiv - Molecular Biology 2022Quote: ... anti-DnaD and anti- DnaB antibodies (Eurogentec) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... The OptimAb HA.11 monoclonal antibody (Eurogentec) was used to detect hemagglutinin (HA)-fusion proteins at the concentration of 0.5 μg/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-DnaD and anti-DnaB antibodies (Eurogentec) for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... an ASPM antibody was generated by Eurogentec by using a 16 amino acid peptide (ac-SVSQKVDRVRSPLQAC-con ...
-
bioRxiv - Microbiology 2020Quote: ... The antibody was produced by Eurogentec (Seraing, Belgium).
-
bioRxiv - Neuroscience 2020Quote: ... and rabbit anti-neurofilament antibodies (Eurogentec, 1/50) followed by an Alexa-conjugated donkey anti-rabbit 488 (Jackson ...
-
bioRxiv - Molecular Biology 2020Quote: ... Antibody production in rabbit was done by Eurogentec (https://secure.eurogentec.com/eu-home.html) ...
-
bioRxiv - Microbiology 2020Quote: ... The antibody’s affinity (Eurogentec; Peptide: 1911009, Rabbit 237) was confirmed through ELISA.
-
bioRxiv - Molecular Biology 2022Quote: ... because detection via our anti-DnaD antibody (Eurogentec) was not fully consistent between wild-type and variant alleles of dnaD ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1.25μg anti-5mC antibody (Eurogentec BI-MECY-0100) and 10μL Dynabeads coupled with M-280 sheep anti-mouse antibody (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibody staining was carried out at room temperature for 1 hour with custom made AOX antibodies (Eurogentec; Peptide: 1911009, Rabbit 237), diluted to 1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibodies against Hcp (Eurogentec; Metzger et al., 2016) were used at 1:5,000 dilution while anti-Sigma70-HRP antibodies (BioLegend ...
-
bioRxiv - Genetics 2021Quote: ... Milk was renewed and added 1/200 antibody (Eurogentec) against AGO104 or AGO105/AGO119 and left overnight with agitation ...
-
bioRxiv - Microbiology 2019Quote: ... Polyclonal Anti-Rv3852 antibody was produced by Eurogentec (30).
-
bioRxiv - Genomics 2020Quote: ... A commercial monoclonal antibody against 5-methylcytidine from Eurogentec was used for immunoprecipitation ...
-
bioRxiv - Neuroscience 2019Quote: Primary antibodies: anti-CNK2 (guinea pig, Eurogentec, custom-made), anti-CNK2 (rabbit ...
-
bioRxiv - Cell Biology 2021Quote: ... Polyclonal antibodies were raised against the fusion protein (Eurogentec). Immuno-reactive complexes were detected using horseradish-peroxidase coupled anti-rabbit or anti-mouse antibodies (Sigma-Aldrich/Merck ...
-
bioRxiv - Plant Biology 2019Quote: ... and used to raise polyclonal antibody in rabbits (Eurogentec). From the crude immunserum specific IgG fraction was isolated as described above.
-
bioRxiv - Molecular Biology 2019Quote: ... Pab-DnaG or Pab-aCPSF1 (custom polyclonal antibodies, Eurogentec) diluted 10,000-fold and an anti-rabbit IgG HRP conjugate (Promega ...
-
bioRxiv - Developmental Biology 2021Quote: Polyclonal anti Am TIG1 antibodies were manufactured by Eurogentec, by raising rabbit antisera against two non-overlapping peptides corresponding to residues MAQVKSVKQRLRND (154 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Antibodies were raised in two guinea pigs by Eurogentec.