Labshake search
Citations for Eurogentec :
51 - 100 of 120 citations for Mouse Direct PCR Kit For Genotyping since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 2µl of PCR product was denatured in 10µl HiDi formamide (Thermo) with 0.5µl Mapmarker ROX 1000 (Eurogentec) and run on an ABI 3730XL genetic analyser ...
-
bioRxiv - Cell Biology 2019Quote: ... mRNA expression was measured by quantitative (Q)-PCR using SYBR Green Mastermix (#RT-SY2X-NRWOU+B, Eurogentec Ltd.) and the DNA Engine Opticon 2 system (BioRad) ...
-
bioRxiv - Physiology 2019Quote: ... cDNA-specific PCR primers were designed using Primer-BLAST (see Table 1) and purchased from Eurogentec (Seraing, Belgium). Gapdh was used as reference gene ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 U of HotGoldStar polymerase and SYBR Green PCR mix as per the manufacturer’s recommendations (Eurogentec, Seraing, Belgium). Amplification was performed as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... random nonamers (Eurogentec Reverse Transcriptase Core Kit) was used to prepare cDNA by using the 200 ng of the total RNA for 10 μl of reaction and the produced cDNA was used for comparative quantitation of mRNA expression ...
-
bioRxiv - Cell Biology 2020Quote: A PLA kit II (Eurogentec, Seraing, BE) was used according to the manufacturer’s instructions with slight modifications ...
-
bioRxiv - Biochemistry 2021Quote: ... Forward and reverse primers for the PCR reaction were designed using the online rf-cloning.org service and purchased from Eurogentec.
-
bioRxiv - Plant Biology 2024Quote: ... Quantitative real-time PCR was performed at 60°C using Takyon No ROX SYBR 2X MasterMix blue dTTP (Eurogentec) in the LightCycler 480 (Roche ...
-
bioRxiv - Genomics 2020Quote: ... 1.25 µl of mouse anti-human 5mC antibody (clone 33D3; Eurogentec Ltd., Cat No. BI-MECY, RRID:AB_2616058), and 10 µl of Dynabeads coupled with M-280 sheep anti-mouse IgG bead (Invitrogen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... mRNA real time quantification was generally performed in a two step format using Eurogentec Reverse Transcriptase Core Kit and MESA GREEN qPCR Master Mix Plus for SYBR Assay with Low Rox kit from Eurogentec following the suppliers’ protocols ...
-
bioRxiv - Cancer Biology 2021Quote: ... mRNA real time quantification was generally performed in a two step format using Eurogentec Reverse Transcriptase Core Kit and MESA GREEN qPCR Master Mix Plus for SYBR Assay with Low Rox kit from Eurogentec following the suppliers’ protocols ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR amplification was performed using MESA Green qPCR MasterMix for SYBR assay (Cat. No. RT-SY2X-03+WOUN, Eurogentec, Ltd.) on a DNA Engine Opticon2 thermocycler (BioRad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time (reverse transcriptase) PCR from cDNA was done with the Mesa Green qPCR Mastermix Plus for SYBR Assay-Low ROX (Eurogentec). For real time based quantification to study comparative differential expression here are list of primers that has been used ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative PCR was performed using primers listed in Table S2 and TakyonLow Rox SYBR MasterMix blue (Eurogentec #UF-LSMT-B0701). Samples were run on an ABI ViiA 7 cycler ...
-
bioRxiv - Genomics 2019Quote: ... All quantitative PCR assays were performed in duplicate with Mesa green qPCR 2x MasterMix Plus (Eurogentec 05-SY2X-06+WOU) on a CFX96 PCR system (Bio-Rad ...
-
bioRxiv - Plant Biology 2020Quote: ... which also contained 10 µl of the Power SYBR green PCR master mix of qPCR master mix plus for SYBR Green I (Eurogentec, Seraing ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative PCR was then performed using an ABI7500 Fast instrument and the MESA Green qPCR MasterMix Plus for SYBR assay (Eurogentec). Relative expression was calculated via the Pfaffl method79 using Gapdh and Polr2a as references gene ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real-time (reverse transcriptase) PCR from cDNA was done with the Mesa Green qPCR Mastermix Plus for SYBR Assay-Low ROX (Eurogentec). 18s rRNA has been used as endogenous control.
-
bioRxiv - Developmental Biology 2022Quote: ... ChIP-qPCRs were carried out in a CFX96TM Real-Time PCR Detection System (Bio Rad) using TakyonTM No Rox SYBR MasterMix dTTP Blue (Eurogentec). Oligonucleotide primers used for ChIP-qPCR are listed in Supplementary Table 1.
-
bioRxiv - Microbiology 2021Quote: ... DNA eluted into 100 μl sample volume was tested in quantitative-PCRs (qPCRs) using primers and probes (Eurogentec, Seraing, Belgium) targeting sequences within metA ...
-
bioRxiv - Microbiology 2022Quote: ... All qRT-PCR assays were carried out in 96-well plates using MESA Blue qPCR MasterMix Plus for SYBR Assay (Eurogentec). Primers for viral genes are shown in Table 1 ...
-
bioRxiv - Plant Biology 2023Quote: Each quantitative PCR reaction was performed in three technical replicates with Takyon™ SYBR® 2X qPCR Mastermix Blue (Eurogentec) in 384-wells plates with a total volume of 10 uL using Light Cycler 480 apparatus (Roche) ...
-
bioRxiv - Cell Biology 2024Quote: ... The RNAi target fragments were amplified by PCR from synthesised copies of TbMYO1 and TbMYO21 in a pUC57 plasmid (Eurogentec). The fragments were ligated into Eam1105I-cut p2T7_TAblue using in vivo assembly (IVA ...
-
bioRxiv - Microbiology 2024Quote: An amount of 2 μL of cDNA was then used for quantitative PCR with the MESA GREEN qPCR MasterMix Plus (Eurogentec) and primers for AID (Forward 5′ AATTCAAAAATGTCCGCTGGGC*T3′ ...
-
bioRxiv - Genomics 2019Quote: ... 0.05% Triton X-100) using 1 µl of mouse monoclonal anti-5-methylcytosine antibody (Eurogentec BI-MECY-0100) or 0,5 µl of rabbit 5-Hydroxymethylcytosine antibody (Active motif 39769) ...
-
bioRxiv - Biochemistry 2021Quote: Anti-TRPM7 2C7 mouse monoclonal antibody (anti-M7d, Figure 1-figure supplement 1) was produced by Eurogentec (Belgium) as follows ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was used for real-time PCR analysis using Takyon Low Rox Probe 2x Master Mix dTTP Blue (Eurogentec, Liège, Belgium) with TaqMan® Assay-on-demand kits (Applied Biosystems ...
-
bioRxiv - Cell Biology 2019Quote: ... Relative copy numbers of the single-copy nuclear-encoded gene beta-2-microglobulin (β2M) and the mitochondrially-encoded gene mtND1 were measured by quantitative (Q)-PCR using SYBR Green Mastermix (Eurogentec Ltd.) and the DNA Engine Opticon 2 system (BioRad) ...
-
bioRxiv - Microbiology 2022Quote: ... All qRT-PCR assays were carried out in 96-well plates using Takyon™ No ROX SYBR 2X MasterMix blue dTTP (Eurogentec). Primers for cellular and viral genes are shown in S1 table ...
-
bioRxiv - Developmental Biology 2022Quote: ... was performed in a CFX96™ Real-Time PCR Detection System (Bio Rad) using TakyonTM No Rox SYBR MasterMix dTTP Blue (Eurogentec). Expression levels were normalised to the reference genes At5G25760 and At4G34270 70 ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was amplified in a 20 µl PCR mix containing 10 µl of Takyon Low Rox SYBR MasterMix dTTP Blue (Eurogentec, Belgium), 2 µl of each primer (final concentration 300 nM) ...
-
bioRxiv - Plant Biology 2023Quote: Gene expressions were measured by mixing 4.3 µL of a 100 fold diluted cDNA suspension with 7.5 µL of MESA Blue 2X PCR MasterMix for SYBR Green Assays with fluorescein (Eurogentec, Liege, Belgium). The mix is complemented with 3 µL of primers according to the optimal concentration allowing an efficiency close to 100% and calculated in previous experiments ...
-
A quantitative tri-fluorescent yeast two-hybrid system: from flow cytometry to in-cellula affinitiesbioRxiv - Biochemistry 2019Quote: ... HA tagged proteins were labeled overnight at 4°C with the mouse HA.11 Clone 16B12 Monoclonal Antibody (Eurogentec) 1/2000 in PBS + tween 0.2% (v/v ...
-
bioRxiv - Physiology 2023Quote: MMP2 and 9 activity assays were used to measure MMP2 and 9 activities in frozen mouse heart tissue and plasma following the manufacturer’s instructions (AS-72017, Eurogentec). MMP9 activity in conditioned media from human ciCMVEC was also assessed.
-
bioRxiv - Plant Biology 2020Quote: ... For qPCR a SYBR Green core qPCR kit (Eurogentec) and a StepOnePlus machine (ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... using MESA BLUE qPCR kit for SYBR assay (Eurogentec) according to the manufacturer’s instructions with primers for 18S (see Table 1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using the SYBR Green I qPCR core kit (Eurogentec). Thermal conditions were 50°C for 2 minutes ...
-
bioRxiv - Plant Biology 2020Quote: ... We used Takyon qPCR Kit for SYBER assay (Eurogentec) and the RT-PCR was carried out in CFX96 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... using MESA BLUE qPCR kit for SYBR assay (Eurogentec) according to the manufacturer’s instructions with primers for 18S (see Table 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Takyon ROX SYBR Master Mix blue dTTP Kit (Eurogentec) was used ...
-
bioRxiv - Immunology 2020Quote: ... The expression of the genes of hexokinase 2 (HK2) and LDH-A was determined using PCR SYBR Green sequence detection system (Eurogentec, Seraing, Belgium) and the CFX Connect™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: ... A region of 168 base pairs on the PB2 protein was amplified by RT-PCR using custom primers (Table S6)(Eurogentec, Maastricht, Netherlands) and the QIAGEN OneStep RT-PCR Kit (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... The expression of the genes HIF-1α and LDH-A was determined using PCR SYBR Green sequence detection system (Eurogentec, Seraing, Belgium) and the CFX Connect Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... and washed with PBS before blocking and primary antibody incubation (mouse-anti 5-methycytosine, Eurogentec, BI-MECY-0100, 1:250). After PBS washes ...
-
bioRxiv - Pathology 2021Quote: ... Reverse transcription was performed using Reverse Transcriptase Core Kit (Eurogentec). qRT-PCR were performed on a LightCycler 480 instrument (Roche ...
-
bioRxiv - Plant Biology 2022Quote: ... 30 s) using Takyon qPCR kit for SYBR assay (Eurogentec) (2.5 µL TAKYON SYBER 2X ...
-
bioRxiv - Physiology 2024Quote: ... and reverse transcribed with the Reverse Transcriptase Core kit (Eurogentec). Gene expression was analyzed by quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Plant Biology 2019Quote: ... cDNA derived from leaf RNA was used for qRT-PCR using Takyon™ No Rox SYBR® MasterMix dTTP Blue (Eurogentec, Lϋttich, Belgium). Quantification of expression was done relative to ACTIN8 (Ralhan et al. ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative PCR (qPCR) was performed on the synthesised cDNA using Takyon™ Low ROX SYBR®master mix ddTTP blue (Eurogentec Liège, Belgium). qPCR was performed in three technical replicates and a non-template control was included ...
-
bioRxiv - Genomics 2020Quote: ... and mRNA expression assayed with a two-step real-time quantitative PCR assay with qPCR MasterMix Plus w/o UNG with SYBR® Green I No Rox (Eurogentec S.A, Seraing, Belgium) using a Lightcycler® 480 Instrument (Roche Applied Science ...