Labshake search
Citations for Eurogentec :
1 - 50 of 107 citations for Estrone 3 Glucuronide E1G ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec).
-
bioRxiv - Microbiology 2020Quote: ... Extracted DNA was incorporated into real-time PCR performed using Metha_16S_2_MBF: 5’-CGAACCGGATTAGATACCCG -3’ and Metha_16S_2_MBR: 5’-CCCGCCAATTCCTTTAAGTT-3’ primers (Eurogentec, Angers, France) and FAM_Metha_16S_2_MBP 6FAM-CCTGGGAAGTACGGTCGCAAG probe targeting the 16S DNA gene of methanogens ...
-
bioRxiv - Immunology 2023Quote: ... Cxcl3 reverse: 5’-CCTTGGGGGTTGAGGCAAACTT-3’ (Eurogentec) for the quantification of Cxcl1 ...
-
bioRxiv - Biophysics 2020Quote: ... Oligonucleotides (c-Myc and ds26; sequences = 5’-TGAGGGTGGGTAGGGTGGGTAA-3’ and 5’-CAATCGGATCGAATTCGATCCGATTG-3’, respectively) were purchased from Eurogentec, and dissolved in 10 mM lithium cacodylate buffer at pH 7.3 ...
-
bioRxiv - Cell Biology 2019Quote: ... For IFT88 knockdown: 5’-GCUGUGAACUCGGAUAGAU-3’ (Eurogentec) or siGENOME Mouse Ift88 (21821 ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5’-CACCGUGUGUCUAAGCAAA-3’ (RCC1 siRNA; Eurogentec).
-
bioRxiv - Cell Biology 2021Quote: ... 5’- ACUGACGACUCUGCUACUC-3’ (Luc; Eurogentec, Seraing, Belgium) or ON-TARGETplus Non-targeting siRNA #1 (Cont ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... reverse primer (5’-GAGACCCTCCGAAAATAGGC −3’) (Eurogentec, Belgium) (1μl)(10μm) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... forward primer (5’-AATTCGGGGAGCGATCCTG −3’) (Eurogentec, Belgium) (1μl)(10μm) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The expression of VEGF (F: 5’-GACTCCGGCGGAAGCAT-3’ R: 5’-TCCGGGCTCGGTGATTTA-3’) was detected with SYBR Green I (Eurogentec). Gene expression was normalised to RPL13A (F ...
-
bioRxiv - Cell Biology 2020Quote: Double-stranded siRNA oligonucleotides used were 5’- CAGUACCAGUGAGUGGCCCCACCUG-3’ (NuMA 3’UTR siRNA; Eurogentec) and 5’-CACCGUGUGUCUAAGCAAA-3’ (RCC1 siRNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... at an annealing temperature of 60°C (forward primer 5’-TCGAACCCTTGCCACTCATC-3’ and reverse primer 5’-GCACAAACGGCCAGGAAATC-3’, synthesised by Eurogentec, Southampton, UK).
-
bioRxiv - Cell Biology 2023Quote: ... hGBF1 (5’- CCUCUGUCAACAAGUUCCU-3’) and control siRNA was purchased from Eurogentec. Following plasmids used in this study were described previously ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNAs were amplified by Q-PCR using 5’ and 3’ oligonucleotides (Eurogentec) specific to each gene ...
-
bioRxiv - Microbiology 2019Quote: ... The tissue sections were incubated with the universal bacterial probe EUB338 (5’-GCTGCCTCCCGTAGGAGT-3’) (Eurogentec, Liège, Belgium) conjugated to Alexa Fluor 594 ...
-
bioRxiv - Microbiology 2023Quote: ... For HuR knockdown experiment we transfected 150nM of either DsiHuR: 5’AUUUCUGAAUCUGUGACGCAAGAAT 3’(IDT) or Nonspecific (Eurogentec) siRNA 24 hrs prior to luciferase construct transfection.
-
bioRxiv - Developmental Biology 2020Quote: ... Non-targeting control siRNA and siRNA duplexes targeting Sorbs1 (5’-UUAAGUCCUGAGUGCUCUUC-3’) were synthesized and purchased from Eurogentec.
-
bioRxiv - Genetics 2019Quote: ... and the resulting immune antisera were tested against the recombinant antigen by ELISA (Eurogentec), and the endogenous protein in mouse testes from WT and KO mice (data not shown) ...
-
bioRxiv - Pathology 2024Quote: ... All reactions were performed in Biorad® 96-well plates with the reagent kit for TaqMan® qPCR assays (Eurogentec), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... a 20 µl mixture containing 3 µl of RNA was prepared using the Low ROX One-Step qRT-PCR 2X MasterMix kit (Eurogentec®, Seraing, Belgium) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Oligonucleotides (Table 3) were synthesized by Eurogentec (Belgium). PCRs were performed in Applied Biosystems 2720 Thermak thermocycler (ABI) ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNA 2 5’ GCCCUAUCCCUUUACGUCA (Eurogentec). Dharmacon ONTarget plus SMARTpool ...
-
bioRxiv - Cell Biology 2019Quote: ... elegans PTC-3 were generated in rabbits by Eurogentec using peptides SASHSSDDESSPAHK and EVRRGPELPKENGLG ...
-
bioRxiv - Pathology 2021Quote: ... angiotensin (Eurogentec #AS20634, 0.5-5 μM)) ...
-
bioRxiv - Neuroscience 2021Quote: ... oligo-dT24-primer (5 µM, Eurogentec), RNasin (80 U ...
-
bioRxiv - Microbiology 2023Quote: ... and 5-FAM-LC-LL37 (Eurogentec) solution (14 µM ...
-
bioRxiv - Microbiology 2024Quote: ... and 5-FAM-LC-LL37 (Eurogentec) solution (14 µM ...
-
bioRxiv - Molecular Biology 2024Quote: A poly(GP) Meso Scale Discovery (MSD®) enzyme-linked immunosorbent assay (ELISA) was established using a custom made rabbit αLGP antibody (Eurogentec) and based on previously described methods16 ...
-
bioRxiv - Cell Biology 2024Quote: ... comprising 5 μL of TakyonTM MasterMix (Eurogentec), 0.5 μL of TaqMan® gene expression assay probes (Table 1) ...
-
bioRxiv - Genomics 2020Quote: ... A commercial monoclonal antibody against 5-methylcytidine from Eurogentec was used for immunoprecipitation ...
-
bioRxiv - Plant Biology 2019Quote: ... Anti-5-methylcytosine (Eurogentec BI-MECY-0100, lot: vt150601) or anti-H3K9me2 (Abcam ab1220 ...
-
bioRxiv - Plant Biology 2021Quote: ... using 384-well plates and Takyon Low Rox SYBR MasterMix dTTP Blue (Eurogentec) on material from three independent biological experiments ...
-
bioRxiv - Biochemistry 2023Quote: ... and/or FAM-peptide substrate (5 μM) (Eurogentec AS-60579-01). Assays were incubated for one hour at 37C with a FAM channel measurement at 1 min intervals in a Thermo Scientific Quantstudio 1 RT-qPCR instrument running Quantstudio Design & Analysis software (v1.5.2) ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-cholesterol-tetraethyleneglycol-modified DNA oligonucleotides were purchased from Eurogentec (Belgium). The scaffold M13mp18 was procured from tilibit nanosystems (Germany) ...
-
bioRxiv - Immunology 2023Quote: ... or an ovalbumin peptide (SIINFEKL, OVA257-264, 5 μM, Eurogentec, Seraing, Belgium). After 48 h of incubation at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... a YF17D NS3 peptide (ATLTYRML, NS3268–275, 5 μM, Eurogentec, Seraing, Belgium) or an ovalbumin peptide (SIINFEKL ...
-
bioRxiv - Microbiology 2021Quote: ... Primer 3 program available online was used for primer design and primers were synthesized by Eurogentec. The primer efficiency was evaluated and primer pairs showing an efficiency between 90 and 110% in the qPCR analysis were selected ...
-
bioRxiv - Microbiology 2020Quote: ... or 500 ng to 3 µg for integrative plasmids (MicroPulserTM electroporator Biorad in 2 mm cuvettes (Eurogentec) at 25 µF ...
-
bioRxiv - Cell Biology 2023Quote: ... CD79α and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was measured by RT-qPCR using Takyon SYBR Master Mix (Eurogentec), 100nM of specific primers ...
-
bioRxiv - Microbiology 2023Quote: Forward primers were marked in 5’ with 6-FAM or HEX fluorophores (Eurogentec®) and when useful ...
-
bioRxiv - Cell Biology 2021Quote: ... 2015b) directly labeled with a fluorophore in 3’ end (sequences are detailed in Table S1) were purchased from Eurogentec. These probes located (Fig ...
-
bioRxiv - Molecular Biology 2021Quote: ... using 2 μl of the diluted cDNAs (1:5) and Takyon Blue Master Mix (Eurogentec). All primers used are listed in Table S9 ...
-
bioRxiv - Developmental Biology 2021Quote: Polyclonal anti-uL11K3me3 antibodies were generated in rabbit using a peptide corresponding to the first 16 amino acids of uL11 with methylated lysine 3 [PPK(me3)FDPTEVKLVYLRC] (Eurogentec). The serum was first loaded on a uL11K3me3 peptide affinity column which allowed to retain anti-uL11K3me3 and anti-uL11 antibodies ...
-
bioRxiv - Immunology 2021Quote: Immunising and screening peptides are outlined in S.Table 2 (Figure 3-figure supplement 2) and were synthesized by Eurogentec (Belgium). A portion was further conjugated to Key Lymphocyte Haemoglutinin (KLH ...
-
bioRxiv - Microbiology 2022Quote: ... All qRT-PCR assays were carried out in 96-well plates using MESA Blue qPCR MasterMix Plus for SYBR Assay (Eurogentec). Primers for viral genes are shown in Table 1 ...
-
bioRxiv - Microbiology 2024Quote: ... All RT-qPCR assays were carried out in 96-well plates using MESA Blue qPCR MasterMix Plus for SYBR Assay (Eurogentec). GLuc was amplified using GLuc forward primer CCTACGAAGGCGACAAAGAG and reverse primer TTGTGCAGTCCACACACAGA and results were normalised by amplifying 18s primer sequences ...
-
bioRxiv - Neuroscience 2021Quote: ... aiming to skip DMD exon 51 (51-[T*C*A*A*G*G*A*A*G*A*T*G*G*C*A*T*T*T*C*T]-3⍰, Eurogentec, Belgium) by transfection with Lipofectamine as described in43,44 and analysed by either myoblot (96 well plates ...
-
bioRxiv - Microbiology 2022Quote: ... All qRT-PCR assays were carried out in 96-well plates using Takyon™ No ROX SYBR 2X MasterMix blue dTTP (Eurogentec). Primers for cellular and viral genes are shown in S1 table ...
-
bioRxiv - Molecular Biology 2021Quote: ... random nonamers (Eurogentec Reverse Transcriptase Core Kit) was used to prepare cDNA by using the 200 ng of the total RNA for 10 μl of reaction and the produced cDNA was used for comparative quantitation of mRNA expression ...
-
bioRxiv - Cell Biology 2020Quote: A PLA kit II (Eurogentec, Seraing, BE) was used according to the manufacturer’s instructions with slight modifications ...