Labshake search
Citations for Eurogentec :
51 - 72 of 72 citations for Ciprofloxacin Hcl 100 Ug Ml In Methanol 2 3 Carboxyl 13C3 99%; Quinoline 15N 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... ligand- and RNA-bound protein samples were prepared in NMR buffer (20 mM Tris, pH 7.6, containing 100 mM KCl, 10% D2O) supplemented with SUPERase·in RNase Inhibitors (Eurogentec) for RNA samples ...
-
bioRxiv - Genomics 2019Quote: ... 0.05% Triton X-100) using 1 µl of mouse monoclonal anti-5-methylcytosine antibody (Eurogentec BI-MECY-0100) or 0,5 µl of rabbit 5-Hydroxymethylcytosine antibody (Active motif 39769) ...
-
bioRxiv - Microbiology 2023Quote: ... a 20 µl mixture containing 3 µl of RNA was prepared using the Low ROX One-Step qRT-PCR 2X MasterMix kit (Eurogentec®, Seraing, Belgium) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The pellet was suspended in 200 µl of PBS and 100 µg aliquot was sent to raise antiserum (Eurogentec). The LytE antiserum was used in Western blot at 1:5000 dilution and with the anti-rabbit secondary antibody (1:10000).
-
bioRxiv - Biophysics 2023Quote: ... Each experiment was performed in a final volume of 100 μL of 10 mM cacodylate Li buffer with 0.2 μM of double-labeled (Fam/Tamra) RNAs (Eurogentec) and either with or without 5 molar equivalents (mol.eq ...
-
bioRxiv - Cell Biology 2022Quote: ... and then with FITC-labelled C-rich telomere probe (1:100 dilution of 5 nmol, PN-TC011-005, Eurogentec) in the dark at RT for 1.5 h ...
-
bioRxiv - Microbiology 2023Quote: ... 100 μl/well polyclonal rabbit antiserum against p24 antigen (Eurogentec, 1:1,000 in PBS-T with 10% (v/v) FCS ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... supernatants (1 μg/mL of lysate) were treated with DNAse I (Eurogentec) for 1 hour on ice ...
-
bioRxiv - Cell Biology 2021Quote: ... or PLEKHA6 (RtSZR127, IB: 1/1000, IF,IHC: 1/100) were generated by immunization of rats (Polyclonal Antibody Production, Eurogentec) with purified N-terminally GST- fused C-terminal fragments of human PLEKHA5 (NP_061885 ...
-
bioRxiv - Microbiology 2021Quote: ... DNA eluted into 100 μl sample volume was tested in quantitative-PCRs (qPCRs) using primers and probes (Eurogentec, Seraing, Belgium) targeting sequences within metA ...
-
bioRxiv - Developmental Biology 2022Quote: ... The genomic DNA was purified from the hippocampal region of the brain tissues (∼10-12mg) using the smart extract-DNA extraction kit as per the supplier’s instruction (Cat# SKDNEX-100, Eurogentec, Belgium). The quantity of total genomic DNAs (gDNA ...
-
bioRxiv - Cell Biology 2022Quote: ... The metaphases were hybridized first with Cy3-labeled G-rich telomere probe (1:100 dilution 5 nmol, PN-TG050-005, Eurogentec) and then with FITC-labelled C-rich telomere probe (1:100 dilution of 5 nmol ...
-
Bridging of nucleosome-proximal DNA double-strand breaks by PARP2 enhances its interaction with HPF1bioRxiv - Biochemistry 2019Quote: ... 44.35 μM (0.1 mg/mL) of H31-21 peptide as substrate (purchased from Eurogentec), no HPF1 or 2 μM HPF1 ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 30 ng/mL M-CSF and 50 ng/mL RANKL as described (Touaitahuata et al.. 2016) using 100 nM siRNA: either Dharmacon siGenome Smartpools or custom oligonucleotides from Eurogentec (Table S11). After 3 hours ...
-
bioRxiv - Biochemistry 2023Quote: ... C+IVAPGEARLGSIKMA for bGIC-1 and C+TAAEGRISGMAIAKS for bGIC-2) were generated as a N-terminal Keyhole limpet haemocyanin fusion to raise the antibodies in rabbits (Eurogentec). For Western blots ...
-
bioRxiv - Microbiology 2024Quote: An amount of 2 μL of cDNA was then used for quantitative PCR with the MESA GREEN qPCR MasterMix Plus (Eurogentec) and primers for AID (Forward 5′ AATTCAAAAATGTCCGCTGGGC*T3′ ...
-
bioRxiv - Cancer Biology 2024Quote: ... Metaphases were denatured at 72°C in 70% formamide/30% 2xSSC solution for 2 min before hybridization to Alexa 488–OO-(CCCTAA)n probe (Eurogentec) at 37°C for 16 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... Relative copy numbers of the single-copy nuclear-encoded gene beta-2-microglobulin (β2M) and the mitochondrially-encoded gene mtND1 were measured by quantitative (Q)-PCR using SYBR Green Mastermix (Eurogentec Ltd.) and the DNA Engine Opticon 2 system (BioRad) ...
-
bioRxiv - Immunology 2020Quote: ... The expression of the genes of hexokinase 2 (HK2) and LDH-A was determined using PCR SYBR Green sequence detection system (Eurogentec, Seraing, Belgium) and the CFX Connect™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Physiology 2019Quote: ... and each sample was run in triplicate with 2 µL of the diluted cDNA and 8 µL of master mix containing 1x qPCR MasterMix Plus Low ROX (Eurogentec, Liège, Belgium) or 1x TaqMan gene expression MasterMix (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... Two tubes were hybridized overnight with 0.5μg/ml of Cy5-labeled G-rich telomere probe (Cat.#PN-TG055-005, Eurogentec) and two tubes were used as unlabeled control ...
-
bioRxiv - Genomics 2021Quote: ... in a final volume of 10 µL (0.5 µL of each primer, 5 µL of Eurogentec Takyon™ SYBR® 2 x qPCR Mastermix Blue). The following Light-Cycler run protocol was used ...