Labshake search
Citations for Eurogentec :
1 - 50 of 76 citations for Catalase Fluorescent Activity Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... In situ hybridization was performed using fluorescent probes from Eurogentec (SI Table S3) in two hybridization rounds at 40% and 15% formamide hybridization buffers according to (Vlaeminck et al. ...
-
bioRxiv - Pathology 2024Quote: ... All reactions were performed in Biorad® 96-well plates with the reagent kit for TaqMan® qPCR assays (Eurogentec), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The short fluorescent ssDNA substrate used in FCS experiments was prepared with synthetic oligonucleotides (Eurogentec) labeled either with Biotin or Alexa-488 in 5’ in order to generate a Biotin-labeled DNA strand and a fluorescently-labeled DNA strand (Sequence ...
-
bioRxiv - Physiology 2023Quote: MMP2 and 9 activity assays were used to measure MMP2 and 9 activities in frozen mouse heart tissue and plasma following the manufacturer’s instructions (AS-72017, Eurogentec). MMP9 activity in conditioned media from human ciCMVEC was also assessed.
-
bioRxiv - Plant Biology 2022Quote: ... SCOOP10#2* (GDIFTGPSGSGHGGGRTPAP) corresponding to SCOOP10#2 without hydroxyprolines was obtained from Eurogentec SA (Seraing ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNA 2 5’ GCCCUAUCCCUUUACGUCA (Eurogentec). Dharmacon ONTarget plus SMARTpool ...
-
bioRxiv - Cell Biology 2023Quote: ... TaqMan 2× Mastermix Plus – Low ROX (Eurogentec), and the related TaqMan assays together with 8 µl of the diluted DNA samples (n=3) ...
-
bioRxiv - Immunology 2021Quote: Immunising and screening peptides are outlined in S.Table 2 (Figure 3-figure supplement 2) and were synthesized by Eurogentec (Belgium). A portion was further conjugated to Key Lymphocyte Haemoglutinin (KLH ...
-
bioRxiv - Immunology 2022Quote: ... and TRAC or TRBC1/2 specific primers (Eurogentec) (see Supplementary file 5 for primer list) ...
-
bioRxiv - Cell Biology 2023Quote: ... and TaqMan 2× Mastermix Plus – Low ROX (Eurogentec) on a ViiA 7 thermocycler (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... using 384-well plates and Takyon Low Rox SYBR MasterMix dTTP Blue (Eurogentec) on material from three independent biological experiments ...
-
bioRxiv - Molecular Biology 2023Quote: DNA sequences (Table 2) were supplied by Eurogentec (Belgium), synthesized on a 1000 nmol scale and purified by reverse phase HPLC ...
-
bioRxiv - Plant Biology 2023Quote: Biotinylated peptides (synthetized by Eurogentec, sequences shown in Fig. 2) were mostly insoluble in water and were thus resuspended in 6 M urea ...
-
bioRxiv - Genetics 2019Quote: ... The purified protein was used to immunize 2 rabbits (Eurogentec, Belgium), and the resulting immune antisera were tested against the recombinant antigen by ELISA (Eurogentec) ...
-
bioRxiv - Cell Biology 2023Quote: The anti-M6 antiserum #2 was generated by immunizing guinea pigs (Eurogentec) with the peptides GKGNNRDRIRDPRE and RRNSYRSDHSLDRYT (corresponding to aa 57–71 and 102–116 in M6 isoform F ...
-
bioRxiv - Biophysics 2019Quote: ... and Oregon Green 488 maleimide were purchased from LIFE TECHNOLOGIES LTD (Paisley, UK) and 6-bromoacetyl-2-dimethylaminonaphthalene (BADAN) from EUROGENTEC (Southampton, UK). N-(2-(iodoacetamido)ethyl)-7-diethylaminocoumarin-3-carboxamide (IDCC ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.3 mg of protein was used per rabbit for immunization of 2 rabbits (Eurogentec). Serum collected from one rabbit was affinity purified against GST-ATI11-180 ...
-
bioRxiv - Microbiology 2022Quote: ... All qRT-PCR assays were carried out in 96-well plates using MESA Blue qPCR MasterMix Plus for SYBR Assay (Eurogentec). Primers for viral genes are shown in Table 1 ...
-
bioRxiv - Microbiology 2024Quote: ... All RT-qPCR assays were carried out in 96-well plates using MESA Blue qPCR MasterMix Plus for SYBR Assay (Eurogentec). GLuc was amplified using GLuc forward primer CCTACGAAGGCGACAAAGAG and reverse primer TTGTGCAGTCCACACACAGA and results were normalised by amplifying 18s primer sequences ...
-
bioRxiv - Molecular Biology 2021Quote: ... using 2 μl of the diluted cDNAs (1:5) and Takyon Blue Master Mix (Eurogentec). All primers used are listed in Table S9 ...
-
bioRxiv - Genomics 2022Quote: Antibodies against H2A.Z.11 (KGLVAAKTMAANKDKC) and H2A.2 (CPKKAGSSKPTEED) peptides were raised in rabbits (Eurogentec) and purified by peptide affinity column ...
-
bioRxiv - Genomics 2023Quote: Antibodies against H2A.Z.11 (KGLVAAKTMAANKDKC) and H2A.2 (CPKKAGSSKPTEED) peptides were raised in rabbits (Eurogentec) and purified by a peptide affinity column ...
-
bioRxiv - Microbiology 2022Quote: ... All qRT-PCR assays were carried out in 96-well plates using Takyon™ No ROX SYBR 2X MasterMix blue dTTP (Eurogentec). Primers for cellular and viral genes are shown in S1 table ...
-
bioRxiv - Molecular Biology 2021Quote: ... random nonamers (Eurogentec Reverse Transcriptase Core Kit) was used to prepare cDNA by using the 200 ng of the total RNA for 10 μl of reaction and the produced cDNA was used for comparative quantitation of mRNA expression ...
-
bioRxiv - Cell Biology 2020Quote: A PLA kit II (Eurogentec, Seraing, BE) was used according to the manufacturer’s instructions with slight modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... Capture antibodies were: our previously described custom rabbit anti-(GR)7 antibody (Eurogentec 2 µg/mL) 90 ...
-
bioRxiv - Molecular Biology 2020Quote: ... mRNA real time quantification was generally performed in a two step format using Eurogentec Reverse Transcriptase Core Kit and MESA GREEN qPCR Master Mix Plus for SYBR Assay with Low Rox kit from Eurogentec following the suppliers’ protocols ...
-
bioRxiv - Cancer Biology 2021Quote: ... mRNA real time quantification was generally performed in a two step format using Eurogentec Reverse Transcriptase Core Kit and MESA GREEN qPCR Master Mix Plus for SYBR Assay with Low Rox kit from Eurogentec following the suppliers’ protocols ...
-
bioRxiv - Microbiology 2020Quote: ... or 500 ng to 3 µg for integrative plasmids (MicroPulserTM electroporator Biorad in 2 mm cuvettes (Eurogentec) at 25 µF ...
-
bioRxiv - Plant Biology 2020Quote: ... For qPCR a SYBR Green core qPCR kit (Eurogentec) and a StepOnePlus machine (ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... using MESA BLUE qPCR kit for SYBR assay (Eurogentec) according to the manufacturer’s instructions with primers for 18S (see Table 1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using the SYBR Green I qPCR core kit (Eurogentec). Thermal conditions were 50°C for 2 minutes ...
-
bioRxiv - Plant Biology 2020Quote: ... We used Takyon qPCR Kit for SYBER assay (Eurogentec) and the RT-PCR was carried out in CFX96 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... using MESA BLUE qPCR kit for SYBR assay (Eurogentec) according to the manufacturer’s instructions with primers for 18S (see Table 1 ...
-
bioRxiv - Genetics 2023Quote: ... and then a Takyon SYBR Green PCR kit (Eurogentec) in a StepOnePlus apparatus (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... Takyon ROX SYBR Master Mix blue dTTP Kit (Eurogentec) was used ...
-
bioRxiv - Pathology 2021Quote: ... Reverse transcription was performed using Reverse Transcriptase Core Kit (Eurogentec). qRT-PCR were performed on a LightCycler 480 instrument (Roche ...
-
bioRxiv - Plant Biology 2022Quote: ... 30 s) using Takyon qPCR kit for SYBR assay (Eurogentec) (2.5 µL TAKYON SYBER 2X ...
-
bioRxiv - Physiology 2024Quote: ... and reverse transcribed with the Reverse Transcriptase Core kit (Eurogentec). Gene expression was analyzed by quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Microbiology 2021Quote: ... and the products were run on a 2% agarose gel at 100 V for 30 mins alongside the 100-1000 bp DNA Ladder (SmartLadder-SF, Eurogentec).
-
bioRxiv - Biochemistry 2023Quote: ... C+IVAPGEARLGSIKMA for bGIC-1 and C+TAAEGRISGMAIAKS for bGIC-2) were generated as a N-terminal Keyhole limpet haemocyanin fusion to raise the antibodies in rabbits (Eurogentec). For Western blots ...
-
bioRxiv - Microbiology 2024Quote: An amount of 2 μL of cDNA was then used for quantitative PCR with the MESA GREEN qPCR MasterMix Plus (Eurogentec) and primers for AID (Forward 5′ AATTCAAAAATGTCCGCTGGGC*T3′ ...
-
bioRxiv - Cancer Biology 2024Quote: ... Metaphases were denatured at 72°C in 70% formamide/30% 2xSSC solution for 2 min before hybridization to Alexa 488–OO-(CCCTAA)n probe (Eurogentec) at 37°C for 16 hours ...
-
bioRxiv - Systems Biology 2021Quote: ... mRNA was reverse transcribed using the Reverse Transcriptase Core kit (Eurogentec). In order to reduce variability in mRNA input ...
-
bioRxiv - Immunology 2021Quote: ... the kit Takyon No ROX SYBR 2X MasterMix blue dTTP (Eurogentec) and the LightCycler480II (Roche Diagnostics ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription was carried out with a reverse transcriptase kit (Eurogentec). Quantitative real-time PCR was performed using a Bio-Rad CFX (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2019Quote: ... Relative copy numbers of the single-copy nuclear-encoded gene beta-2-microglobulin (β2M) and the mitochondrially-encoded gene mtND1 were measured by quantitative (Q)-PCR using SYBR Green Mastermix (Eurogentec Ltd.) and the DNA Engine Opticon 2 system (BioRad) ...
-
bioRxiv - Cancer Biology 2020Quote: All reactions were performed with the qPCR Core Kit (Eurogentec, Seraing, Belgium) in a total reaction volume of 10 μl in 384-well plates ...
-
bioRxiv - Microbiology 2019Quote: ... using the Mesa Blue qPCR Mastermix Plus for Sybr assay kit (Eurogentec). Each reaction was performed in triplicate on three separate occasions ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA (200 ng) was reverse transcribed using Reverse Transcription Core Kit (Eurogentec). Real-time PCR was performed in a 20 μL final volume using the Takyon No Rox SYBR kit (Eurogentec) ...