Labshake search
Citations for Eurogentec :
1 - 50 of 153 citations for 7 methyl 4 methylidene 1 propan 2 yl 2 3 4a 5 6 8a hexahydro 1H naphthalene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... siRNA 2 5’ GCCCUAUCCCUUUACGUCA (Eurogentec). Dharmacon ONTarget plus SMARTpool ...
-
bioRxiv - Molecular Biology 2021Quote: ... using 2 μl of the diluted cDNAs (1:5) and Takyon Blue Master Mix (Eurogentec). All primers used are listed in Table S9 ...
-
bioRxiv - Biophysics 2019Quote: ... and Oregon Green 488 maleimide were purchased from LIFE TECHNOLOGIES LTD (Paisley, UK) and 6-bromoacetyl-2-dimethylaminonaphthalene (BADAN) from EUROGENTEC (Southampton, UK). N-(2-(iodoacetamido)ethyl)-7-diethylaminocoumarin-3-carboxamide (IDCC ...
-
bioRxiv - Immunology 2021Quote: Immunising and screening peptides are outlined in S.Table 2 (Figure 3-figure supplement 2) and were synthesized by Eurogentec (Belgium). A portion was further conjugated to Key Lymphocyte Haemoglutinin (KLH ...
-
bioRxiv - Neuroscience 2023Quote: ... Capture antibodies were: our previously described custom rabbit anti-(GR)7 antibody (Eurogentec 2 µg/mL) 90 ...
-
bioRxiv - Developmental Biology 2022Quote: ... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec).
-
bioRxiv - Microbiology 2020Quote: ... Extracted DNA was incorporated into real-time PCR performed using Metha_16S_2_MBF: 5’-CGAACCGGATTAGATACCCG -3’ and Metha_16S_2_MBR: 5’-CCCGCCAATTCCTTTAAGTT-3’ primers (Eurogentec, Angers, France) and FAM_Metha_16S_2_MBP 6FAM-CCTGGGAAGTACGGTCGCAAG probe targeting the 16S DNA gene of methanogens ...
-
bioRxiv - Immunology 2023Quote: ... Cxcl3 reverse: 5’-CCTTGGGGGTTGAGGCAAACTT-3’ (Eurogentec) for the quantification of Cxcl1 ...
-
bioRxiv - Microbiology 2020Quote: ... or 500 ng to 3 µg for integrative plasmids (MicroPulserTM electroporator Biorad in 2 mm cuvettes (Eurogentec) at 25 µF ...
-
bioRxiv - Biophysics 2020Quote: ... Oligonucleotides (c-Myc and ds26; sequences = 5’-TGAGGGTGGGTAGGGTGGGTAA-3’ and 5’-CAATCGGATCGAATTCGATCCGATTG-3’, respectively) were purchased from Eurogentec, and dissolved in 10 mM lithium cacodylate buffer at pH 7.3 ...
-
bioRxiv - Cell Biology 2019Quote: ... For IFT88 knockdown: 5’-GCUGUGAACUCGGAUAGAU-3’ (Eurogentec) or siGENOME Mouse Ift88 (21821 ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5’-CACCGUGUGUCUAAGCAAA-3’ (RCC1 siRNA; Eurogentec).
-
bioRxiv - Cell Biology 2021Quote: ... 5’- ACUGACGACUCUGCUACUC-3’ (Luc; Eurogentec, Seraing, Belgium) or ON-TARGETplus Non-targeting siRNA #1 (Cont ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... reverse primer (5’-GAGACCCTCCGAAAATAGGC −3’) (Eurogentec, Belgium) (1μl)(10μm) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... forward primer (5’-AATTCGGGGAGCGATCCTG −3’) (Eurogentec, Belgium) (1μl)(10μm) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The expression of VEGF (F: 5’-GACTCCGGCGGAAGCAT-3’ R: 5’-TCCGGGCTCGGTGATTTA-3’) was detected with SYBR Green I (Eurogentec). Gene expression was normalised to RPL13A (F ...
-
bioRxiv - Plant Biology 2022Quote: ... SCOOP10#2* (GDIFTGPSGSGHGGGRTPAP) corresponding to SCOOP10#2 without hydroxyprolines was obtained from Eurogentec SA (Seraing ...
-
bioRxiv - Cell Biology 2020Quote: Double-stranded siRNA oligonucleotides used were 5’- CAGUACCAGUGAGUGGCCCCACCUG-3’ (NuMA 3’UTR siRNA; Eurogentec) and 5’-CACCGUGUGUCUAAGCAAA-3’ (RCC1 siRNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... at an annealing temperature of 60°C (forward primer 5’-TCGAACCCTTGCCACTCATC-3’ and reverse primer 5’-GCACAAACGGCCAGGAAATC-3’, synthesised by Eurogentec, Southampton, UK).
-
bioRxiv - Cell Biology 2023Quote: ... TaqMan 2× Mastermix Plus – Low ROX (Eurogentec), and the related TaqMan assays together with 8 µl of the diluted DNA samples (n=3) ...
-
bioRxiv - Cell Biology 2023Quote: ... hGBF1 (5’- CCUCUGUCAACAAGUUCCU-3’) and control siRNA was purchased from Eurogentec. Following plasmids used in this study were described previously ...
-
bioRxiv - Immunology 2022Quote: ... and TRAC or TRBC1/2 specific primers (Eurogentec) (see Supplementary file 5 for primer list) ...
-
bioRxiv - Cell Biology 2023Quote: ... and TaqMan 2× Mastermix Plus – Low ROX (Eurogentec) on a ViiA 7 thermocycler (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: Forward primers were marked in 5’ with 6-FAM or HEX fluorophores (Eurogentec®) and when useful ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNAs were amplified by Q-PCR using 5’ and 3’ oligonucleotides (Eurogentec) specific to each gene ...
-
bioRxiv - Molecular Biology 2023Quote: DNA sequences (Table 2) were supplied by Eurogentec (Belgium), synthesized on a 1000 nmol scale and purified by reverse phase HPLC ...
-
bioRxiv - Genomics 2021Quote: ... in a final volume of 10 µL (0.5 µL of each primer, 5 µL of Eurogentec Takyon™ SYBR® 2 x qPCR Mastermix Blue). The following Light-Cycler run protocol was used ...
-
bioRxiv - Plant Biology 2023Quote: Biotinylated peptides (synthetized by Eurogentec, sequences shown in Fig. 2) were mostly insoluble in water and were thus resuspended in 6 M urea ...
-
bioRxiv - Genetics 2019Quote: ... The purified protein was used to immunize 2 rabbits (Eurogentec, Belgium), and the resulting immune antisera were tested against the recombinant antigen by ELISA (Eurogentec) ...
-
bioRxiv - Cell Biology 2023Quote: The anti-M6 antiserum #2 was generated by immunizing guinea pigs (Eurogentec) with the peptides GKGNNRDRIRDPRE and RRNSYRSDHSLDRYT (corresponding to aa 57–71 and 102–116 in M6 isoform F ...
-
bioRxiv - Microbiology 2019Quote: ... The tissue sections were incubated with the universal bacterial probe EUB338 (5’-GCTGCCTCCCGTAGGAGT-3’) (Eurogentec, Liège, Belgium) conjugated to Alexa Fluor 594 ...
-
bioRxiv - Microbiology 2023Quote: ... For HuR knockdown experiment we transfected 150nM of either DsiHuR: 5’AUUUCUGAAUCUGUGACGCAAGAAT 3’(IDT) or Nonspecific (Eurogentec) siRNA 24 hrs prior to luciferase construct transfection.
-
bioRxiv - Molecular Biology 2021Quote: ... the cells were incubated in Opti-MEM for 5–6 h with Ambion pre-designed Silencer-Select siRNA or custom-designed siRNA from Eurogentec or scrambled siRNA (control siRNA ...
-
bioRxiv - Developmental Biology 2020Quote: ... Non-targeting control siRNA and siRNA duplexes targeting Sorbs1 (5’-UUAAGUCCUGAGUGCUCUUC-3’) were synthesized and purchased from Eurogentec.
-
bioRxiv - Molecular Biology 2023Quote: ... 0.3 mg of protein was used per rabbit for immunization of 2 rabbits (Eurogentec). Serum collected from one rabbit was affinity purified against GST-ATI11-180 ...
-
bioRxiv - Genomics 2022Quote: Antibodies against H2A.Z.11 (KGLVAAKTMAANKDKC) and H2A.2 (CPKKAGSSKPTEED) peptides were raised in rabbits (Eurogentec) and purified by peptide affinity column ...
-
bioRxiv - Genomics 2023Quote: Antibodies against H2A.Z.11 (KGLVAAKTMAANKDKC) and H2A.2 (CPKKAGSSKPTEED) peptides were raised in rabbits (Eurogentec) and purified by a peptide affinity column ...
-
bioRxiv - Microbiology 2021Quote: ... and the products were run on a 2% agarose gel at 100 V for 30 mins alongside the 100-1000 bp DNA Ladder (SmartLadder-SF, Eurogentec).
-
bioRxiv - Biochemistry 2023Quote: ... C+IVAPGEARLGSIKMA for bGIC-1 and C+TAAEGRISGMAIAKS for bGIC-2) were generated as a N-terminal Keyhole limpet haemocyanin fusion to raise the antibodies in rabbits (Eurogentec). For Western blots ...
-
bioRxiv - Microbiology 2024Quote: An amount of 2 μL of cDNA was then used for quantitative PCR with the MESA GREEN qPCR MasterMix Plus (Eurogentec) and primers for AID (Forward 5′ AATTCAAAAATGTCCGCTGGGC*T3′ ...
-
bioRxiv - Cancer Biology 2024Quote: ... Metaphases were denatured at 72°C in 70% formamide/30% 2xSSC solution for 2 min before hybridization to Alexa 488–OO-(CCCTAA)n probe (Eurogentec) at 37°C for 16 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... Relative copy numbers of the single-copy nuclear-encoded gene beta-2-microglobulin (β2M) and the mitochondrially-encoded gene mtND1 were measured by quantitative (Q)-PCR using SYBR Green Mastermix (Eurogentec Ltd.) and the DNA Engine Opticon 2 system (BioRad) ...
-
bioRxiv - Immunology 2020Quote: ... The expression of the genes of hexokinase 2 (HK2) and LDH-A was determined using PCR SYBR Green sequence detection system (Eurogentec, Seraing, Belgium) and the CFX Connect™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Physiology 2019Quote: ... and each sample was run in triplicate with 2 µL of the diluted cDNA and 8 µL of master mix containing 1x qPCR MasterMix Plus Low ROX (Eurogentec, Liège, Belgium) or 1x TaqMan gene expression MasterMix (Thermo Fisher Scientific ...
-
An Azobenzene G-quadruplex Ligand Exhibits Promising Antibacterial Activity against Escherichia colibioRxiv - Microbiology 2022Quote: All oligonucleotides used (Table 6) were purchased from Eurogentec (Belgium), purified by HPLC and delivered dry ...
-
bioRxiv - Cancer Biology 2023Quote: ... 8-week-old tamoxified ElaK mice received 7 hourly intraperitoneal injections of cerulein (AS-24252, Eurogentec. 100-150 μl in phosphate buffered saline-PBS ...
-
bioRxiv - Genomics 2019Quote: ... 0.05% Triton X-100) using 1 µl of mouse monoclonal anti-5-methylcytosine antibody (Eurogentec BI-MECY-0100) or 0,5 µl of rabbit 5-Hydroxymethylcytosine antibody (Active motif 39769) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Antibodies against the H2A.W.6 phosphopeptide (CEEKATKSPVKSpPKKA) were raised in rabbits (Eurogentec) and purified by peptide affinity column ...
-
bioRxiv - Microbiology 2019Quote: ... Oligonucleotides (Table 3) were synthesized by Eurogentec (Belgium). PCRs were performed in Applied Biosystems 2720 Thermak thermocycler (ABI) ...
-
bioRxiv - Cell Biology 2022Quote: ... and then with FITC-labelled C-rich telomere probe (1:100 dilution of 5 nmol, PN-TC011-005, Eurogentec) in the dark at RT for 1.5 h ...