Labshake search
Citations for Eurogentec :
51 - 68 of 68 citations for 7 Chloro 3 nitro 3 4 dihydro 1H quinolin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: The anti-M6 antiserum #2 was generated by immunizing guinea pigs (Eurogentec) with the peptides GKGNNRDRIRDPRE and RRNSYRSDHSLDRYT (corresponding to aa 57–71 and 102–116 in M6 isoform F ...
-
bioRxiv - Biophysics 2019Quote: ... and Oregon Green 488 maleimide were purchased from LIFE TECHNOLOGIES LTD (Paisley, UK) and 6-bromoacetyl-2-dimethylaminonaphthalene (BADAN) from EUROGENTEC (Southampton, UK). N-(2-(iodoacetamido)ethyl)-7-diethylaminocoumarin-3-carboxamide (IDCC ...
-
bioRxiv - Biochemistry 2023Quote: ... Membranes were then overnight incubated at 4°C with the anti-HA primary antibody (OptimAb HA. 11, Eurogentec), which was raised from mouse serum ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.3 mg of protein was used per rabbit for immunization of 2 rabbits (Eurogentec). Serum collected from one rabbit was affinity purified against GST-ATI11-180 ...
-
A quantitative tri-fluorescent yeast two-hybrid system: from flow cytometry to in-cellula affinitiesbioRxiv - Biochemistry 2019Quote: ... HA tagged proteins were labeled overnight at 4°C with the mouse HA.11 Clone 16B12 Monoclonal Antibody (Eurogentec) 1/2000 in PBS + tween 0.2% (v/v ...
-
bioRxiv - Molecular Biology 2021Quote: ... using 2 μl of the diluted cDNAs (1:5) and Takyon Blue Master Mix (Eurogentec). All primers used are listed in Table S9 ...
-
bioRxiv - Genomics 2022Quote: Antibodies against H2A.Z.11 (KGLVAAKTMAANKDKC) and H2A.2 (CPKKAGSSKPTEED) peptides were raised in rabbits (Eurogentec) and purified by peptide affinity column ...
-
bioRxiv - Genomics 2023Quote: Antibodies against H2A.Z.11 (KGLVAAKTMAANKDKC) and H2A.2 (CPKKAGSSKPTEED) peptides were raised in rabbits (Eurogentec) and purified by a peptide affinity column ...
-
bioRxiv - Plant Biology 2024Quote: ... 4 µl of the diluted cDNA was used together with Takyon No Rox SYBR MasterMix dTTP Blue (Eurogentec, Seraing, Belgium). AT3G01150 was chosen as reference gene (Czechowski et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... We amplified 4 µL cDNA (50 ng) using 10 µL of Takyon™ No Rox SYBR MasterMix Blue dTTP (Eurogentec, Liege, Belgium), 2 µL of each reverse and forward primers (10 mM) ...
-
bioRxiv - Microbiology 2021Quote: ... and the products were run on a 2% agarose gel at 100 V for 30 mins alongside the 100-1000 bp DNA Ladder (SmartLadder-SF, Eurogentec).
-
bioRxiv - Biochemistry 2023Quote: ... C+IVAPGEARLGSIKMA for bGIC-1 and C+TAAEGRISGMAIAKS for bGIC-2) were generated as a N-terminal Keyhole limpet haemocyanin fusion to raise the antibodies in rabbits (Eurogentec). For Western blots ...
-
bioRxiv - Microbiology 2024Quote: An amount of 2 μL of cDNA was then used for quantitative PCR with the MESA GREEN qPCR MasterMix Plus (Eurogentec) and primers for AID (Forward 5′ AATTCAAAAATGTCCGCTGGGC*T3′ ...
-
bioRxiv - Cancer Biology 2024Quote: ... Metaphases were denatured at 72°C in 70% formamide/30% 2xSSC solution for 2 min before hybridization to Alexa 488–OO-(CCCTAA)n probe (Eurogentec) at 37°C for 16 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... Relative copy numbers of the single-copy nuclear-encoded gene beta-2-microglobulin (β2M) and the mitochondrially-encoded gene mtND1 were measured by quantitative (Q)-PCR using SYBR Green Mastermix (Eurogentec Ltd.) and the DNA Engine Opticon 2 system (BioRad) ...
-
bioRxiv - Immunology 2020Quote: ... The expression of the genes of hexokinase 2 (HK2) and LDH-A was determined using PCR SYBR Green sequence detection system (Eurogentec, Seraing, Belgium) and the CFX Connect™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Physiology 2019Quote: ... and each sample was run in triplicate with 2 µL of the diluted cDNA and 8 µL of master mix containing 1x qPCR MasterMix Plus Low ROX (Eurogentec, Liège, Belgium) or 1x TaqMan gene expression MasterMix (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... in a final volume of 10 µL (0.5 µL of each primer, 5 µL of Eurogentec Takyon™ SYBR® 2 x qPCR Mastermix Blue). The following Light-Cycler run protocol was used ...