Labshake search
Citations for Eurogentec :
1 - 50 of 117 citations for 6 Pteridinepropanoic acid 2 4 diamino α 4 methoxycarbonyl phenyl α 2 propyn 1 yl methyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... and α-BAK1 (1/5,000; custom-made by Eurogentec). For the uncropped blots see Figure S3.
-
bioRxiv - Plant Biology 2021Quote: ... 10-25 μl of the extracts were analyzed by SDS-PAGE followed by western blot with α-HA or α-TPL (Eurogentec, Belgium). The latter (polyclonal ...
-
bioRxiv - Molecular Biology 2022Quote: ... Proteins were probed via α-DnaD polyclonal primary antibodies (Eurogentec) and then detected with an anti-rabbit horseradish peroxidase-linked secondary antibody (A6154 ...
-
bioRxiv - Biophysics 2019Quote: ... and Oregon Green 488 maleimide were purchased from LIFE TECHNOLOGIES LTD (Paisley, UK) and 6-bromoacetyl-2-dimethylaminonaphthalene (BADAN) from EUROGENTEC (Southampton, UK). N-(2-(iodoacetamido)ethyl)-7-diethylaminocoumarin-3-carboxamide (IDCC ...
-
bioRxiv - Cell Biology 2021Quote: The polyclonal rabbit phospho-ACBD5 Ser269 antibody (α-ACBD5 pS269) was produced by Eurogentec (Seraing, Belgium). The antibody was raised against peptide 264EVYCDSMEQFGQE276 including a phospho-Ser269 ...
-
bioRxiv - Plant Biology 2022Quote: ... SCOOP10#2* (GDIFTGPSGSGHGGGRTPAP) corresponding to SCOOP10#2 without hydroxyprolines was obtained from Eurogentec SA (Seraing ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNA 2 5’ GCCCUAUCCCUUUACGUCA (Eurogentec). Dharmacon ONTarget plus SMARTpool ...
-
bioRxiv - Physiology 2023Quote: ... Fluorescein-Trp25-Exendin-4 (FLEX; Eurogentec; 0.5μg/μL), Exendin-9 (Ex9 ...
-
bioRxiv - Molecular Biology 2020Quote: ... in cuvettes with a 4-mm inter-electrode distance (Eurogentec). Transfected cells were grown for 48 h in the presence of 7 µM ouabain (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... TaqMan 2× Mastermix Plus – Low ROX (Eurogentec), and the related TaqMan assays together with 8 µl of the diluted DNA samples (n=3) ...
-
bioRxiv - Molecular Biology 2021Quote: ... using 2 μl of the diluted cDNAs (1:5) and Takyon Blue Master Mix (Eurogentec). All primers used are listed in Table S9 ...
-
bioRxiv - Immunology 2021Quote: Immunising and screening peptides are outlined in S.Table 2 (Figure 3-figure supplement 2) and were synthesized by Eurogentec (Belgium). A portion was further conjugated to Key Lymphocyte Haemoglutinin (KLH ...
-
bioRxiv - Immunology 2022Quote: ... and TRAC or TRBC1/2 specific primers (Eurogentec) (see Supplementary file 5 for primer list) ...
-
bioRxiv - Cell Biology 2023Quote: ... and TaqMan 2× Mastermix Plus – Low ROX (Eurogentec) on a ViiA 7 thermocycler (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primers were purchased from Qiagen (miScript Primer Assay range) and from Eurogentec (primer list Supp. Table 4) to respectively amplify miRNA and mRNA ...
-
bioRxiv - Molecular Biology 2023Quote: DNA sequences (Table 2) were supplied by Eurogentec (Belgium), synthesized on a 1000 nmol scale and purified by reverse phase HPLC ...
-
bioRxiv - Plant Biology 2023Quote: Biotinylated peptides (synthetized by Eurogentec, sequences shown in Fig. 2) were mostly insoluble in water and were thus resuspended in 6 M urea ...
-
bioRxiv - Molecular Biology 2022Quote: ... membranes were blocked in 5% milk PBS-T (1X PBS buffer with 0.1% Tween-20) and incubated overnight at 4°C with one of the following antibodies: anti-HA.11 (1:2,000; Eurogentec, Cat# MMS-101P-500), anti-Stm1 (1:10,000 ...
-
bioRxiv - Molecular Biology 2022Quote: ... After an overnight incubation at 4°C with the primary antibodies (anti-5mC, Eurogentec, ref BI-MECY-0100 ...
-
bioRxiv - Genetics 2019Quote: ... The purified protein was used to immunize 2 rabbits (Eurogentec, Belgium), and the resulting immune antisera were tested against the recombinant antigen by ELISA (Eurogentec) ...
-
bioRxiv - Cell Biology 2023Quote: The anti-M6 antiserum #2 was generated by immunizing guinea pigs (Eurogentec) with the peptides GKGNNRDRIRDPRE and RRNSYRSDHSLDRYT (corresponding to aa 57–71 and 102–116 in M6 isoform F ...
-
bioRxiv - Biochemistry 2023Quote: ... Membranes were then overnight incubated at 4°C with the anti-HA primary antibody (OptimAb HA. 11, Eurogentec), which was raised from mouse serum ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.3 mg of protein was used per rabbit for immunization of 2 rabbits (Eurogentec). Serum collected from one rabbit was affinity purified against GST-ATI11-180 ...
-
A quantitative tri-fluorescent yeast two-hybrid system: from flow cytometry to in-cellula affinitiesbioRxiv - Biochemistry 2019Quote: ... HA tagged proteins were labeled overnight at 4°C with the mouse HA.11 Clone 16B12 Monoclonal Antibody (Eurogentec) 1/2000 in PBS + tween 0.2% (v/v ...
-
bioRxiv - Genomics 2022Quote: Antibodies against H2A.Z.11 (KGLVAAKTMAANKDKC) and H2A.2 (CPKKAGSSKPTEED) peptides were raised in rabbits (Eurogentec) and purified by peptide affinity column ...
-
bioRxiv - Genomics 2023Quote: Antibodies against H2A.Z.11 (KGLVAAKTMAANKDKC) and H2A.2 (CPKKAGSSKPTEED) peptides were raised in rabbits (Eurogentec) and purified by a peptide affinity column ...
-
bioRxiv - Plant Biology 2024Quote: ... 4 µl of the diluted cDNA was used together with Takyon No Rox SYBR MasterMix dTTP Blue (Eurogentec, Seraing, Belgium). AT3G01150 was chosen as reference gene (Czechowski et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... Capture antibodies were: our previously described custom rabbit anti-(GR)7 antibody (Eurogentec 2 µg/mL) 90 ...
-
bioRxiv - Microbiology 2020Quote: ... or 500 ng to 3 µg for integrative plasmids (MicroPulserTM electroporator Biorad in 2 mm cuvettes (Eurogentec) at 25 µF ...
-
bioRxiv - Cell Biology 2021Quote: ... We amplified 4 µL cDNA (50 ng) using 10 µL of Takyon™ No Rox SYBR MasterMix Blue dTTP (Eurogentec, Liege, Belgium), 2 µL of each reverse and forward primers (10 mM) ...
-
bioRxiv - Microbiology 2021Quote: ... and the products were run on a 2% agarose gel at 100 V for 30 mins alongside the 100-1000 bp DNA Ladder (SmartLadder-SF, Eurogentec).
-
bioRxiv - Biochemistry 2023Quote: ... C+IVAPGEARLGSIKMA for bGIC-1 and C+TAAEGRISGMAIAKS for bGIC-2) were generated as a N-terminal Keyhole limpet haemocyanin fusion to raise the antibodies in rabbits (Eurogentec). For Western blots ...
-
bioRxiv - Microbiology 2024Quote: An amount of 2 μL of cDNA was then used for quantitative PCR with the MESA GREEN qPCR MasterMix Plus (Eurogentec) and primers for AID (Forward 5′ AATTCAAAAATGTCCGCTGGGC*T3′ ...
-
bioRxiv - Cancer Biology 2024Quote: ... Metaphases were denatured at 72°C in 70% formamide/30% 2xSSC solution for 2 min before hybridization to Alexa 488–OO-(CCCTAA)n probe (Eurogentec) at 37°C for 16 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... Relative copy numbers of the single-copy nuclear-encoded gene beta-2-microglobulin (β2M) and the mitochondrially-encoded gene mtND1 were measured by quantitative (Q)-PCR using SYBR Green Mastermix (Eurogentec Ltd.) and the DNA Engine Opticon 2 system (BioRad) ...
-
bioRxiv - Immunology 2020Quote: ... The expression of the genes of hexokinase 2 (HK2) and LDH-A was determined using PCR SYBR Green sequence detection system (Eurogentec, Seraing, Belgium) and the CFX Connect™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Physiology 2019Quote: ... and each sample was run in triplicate with 2 µL of the diluted cDNA and 8 µL of master mix containing 1x qPCR MasterMix Plus Low ROX (Eurogentec, Liège, Belgium) or 1x TaqMan gene expression MasterMix (Thermo Fisher Scientific ...
-
An Azobenzene G-quadruplex Ligand Exhibits Promising Antibacterial Activity against Escherichia colibioRxiv - Microbiology 2022Quote: All oligonucleotides used (Table 6) were purchased from Eurogentec (Belgium), purified by HPLC and delivered dry ...
-
bioRxiv - Microbiology 2020Quote: A 16 amino acids peptide (nh2-CMHRDYNHDMSDKHRA −conh2) was designed by Eurogentec based on the provide sequence of AOX of Naegleria gruberi (XP_002672918 ...
-
bioRxiv - Genomics 2021Quote: ... in a final volume of 10 µL (0.5 µL of each primer, 5 µL of Eurogentec Takyon™ SYBR® 2 x qPCR Mastermix Blue). The following Light-Cycler run protocol was used ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Antibodies against the H2A.W.6 phosphopeptide (CEEKATKSPVKSpPKKA) were raised in rabbits (Eurogentec) and purified by peptide affinity column ...
-
bioRxiv - Microbiology 2020Quote: ... 6 M urea and used to immunize rabbits (Eurogentec, 28-day speedy protocol). The α-CglB 1° pAb produced was then tested for specificity by using the wild-type and the ΩcglB strains ...
-
bioRxiv - Plant Biology 2023Quote: ... The ad-hoc designed peptide nucleotide acid (PNA) blocker oligos (Kaneka Eurogentec S.A., Belgium) for V ...
-
bioRxiv - Microbiology 2023Quote: Forward primers were marked in 5’ with 6-FAM or HEX fluorophores (Eurogentec®) and when useful ...
-
bioRxiv - Genetics 2023Quote: ... Target sequences (primer list in Additional file 6) were amplified with MESA BLUE qPCR MasterMix Plus (Eurogentec) or KAPA SYBR FAST Roche LightCycler 480 qPCR Master Mix (Kapa Biosystems ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The primer set with Locked Nucleic Acids (LNA; underlined position in probe sequences) was purchased from Eurogentec (Seraing, Belgium): 11-FW ...
-
bioRxiv - Cell Biology 2024Quote: Anti-TbMyo1 antibodies were generated by immunisation of two rabbits with purified recombinant TbMyo1 (amino acids 729–1,168) (Eurogentec). For recombinant protein expression the TbMyo1 tail was cloned into a pET-28a(+ ...
-
bioRxiv - Developmental Biology 2021Quote: Polyclonal anti-uL11K3me3 antibodies were generated in rabbit using a peptide corresponding to the first 16 amino acids of uL11 with methylated lysine 3 [PPK(me3)FDPTEVKLVYLRC] (Eurogentec). The serum was first loaded on a uL11K3me3 peptide affinity column which allowed to retain anti-uL11K3me3 and anti-uL11 antibodies ...
-
bioRxiv - Molecular Biology 2021Quote: ... the cells were incubated in Opti-MEM for 5–6 h with Ambion pre-designed Silencer-Select siRNA or custom-designed siRNA from Eurogentec or scrambled siRNA (control siRNA ...
-
bioRxiv - Developmental Biology 2020Quote: DILP2 peptide corresponding to the sequence TRQRQGIVERC (amino acids 108-118) was used as an immunogen to raise DILP2 polyclonal antibody in rabbit (Eurogentec, Belgium). Mouse anti-GFP (Cat ...