Labshake search
Citations for Eurogentec :
51 - 84 of 84 citations for 6 Hydroxy 2 4 5 triaminopyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Membranes were then overnight incubated at 4°C with the anti-HA primary antibody (OptimAb HA. 11, Eurogentec), which was raised from mouse serum ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.3 mg of protein was used per rabbit for immunization of 2 rabbits (Eurogentec). Serum collected from one rabbit was affinity purified against GST-ATI11-180 ...
-
bioRxiv - Microbiology 2019Quote: ... The tissue sections were incubated with the universal bacterial probe EUB338 (5’-GCTGCCTCCCGTAGGAGT-3’) (Eurogentec, Liège, Belgium) conjugated to Alexa Fluor 594 ...
-
bioRxiv - Microbiology 2023Quote: ... For HuR knockdown experiment we transfected 150nM of either DsiHuR: 5’AUUUCUGAAUCUGUGACGCAAGAAT 3’(IDT) or Nonspecific (Eurogentec) siRNA 24 hrs prior to luciferase construct transfection.
-
A quantitative tri-fluorescent yeast two-hybrid system: from flow cytometry to in-cellula affinitiesbioRxiv - Biochemistry 2019Quote: ... HA tagged proteins were labeled overnight at 4°C with the mouse HA.11 Clone 16B12 Monoclonal Antibody (Eurogentec) 1/2000 in PBS + tween 0.2% (v/v ...
-
bioRxiv - Genomics 2022Quote: Antibodies against H2A.Z.11 (KGLVAAKTMAANKDKC) and H2A.2 (CPKKAGSSKPTEED) peptides were raised in rabbits (Eurogentec) and purified by peptide affinity column ...
-
bioRxiv - Genomics 2023Quote: Antibodies against H2A.Z.11 (KGLVAAKTMAANKDKC) and H2A.2 (CPKKAGSSKPTEED) peptides were raised in rabbits (Eurogentec) and purified by a peptide affinity column ...
-
bioRxiv - Developmental Biology 2020Quote: ... Non-targeting control siRNA and siRNA duplexes targeting Sorbs1 (5’-UUAAGUCCUGAGUGCUCUUC-3’) were synthesized and purchased from Eurogentec.
-
bioRxiv - Plant Biology 2021Quote: ... in 10 µl mixtures each containing 5 µl of Takyon™ ROX SYBR® MasterMix dTTP Blue (Eurogentec, UF-RSMT-B0710 ...
-
bioRxiv - Genomics 2019Quote: ... 0.05% Triton X-100) using 1 µl of mouse monoclonal anti-5-methylcytosine antibody (Eurogentec BI-MECY-0100) or 0,5 µl of rabbit 5-Hydroxymethylcytosine antibody (Active motif 39769) ...
-
bioRxiv - Plant Biology 2024Quote: ... 4 µl of the diluted cDNA was used together with Takyon No Rox SYBR MasterMix dTTP Blue (Eurogentec, Seraing, Belgium). AT3G01150 was chosen as reference gene (Czechowski et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... Capture antibodies were: our previously described custom rabbit anti-(GR)7 antibody (Eurogentec 2 µg/mL) 90 ...
-
bioRxiv - Physiology 2019Quote: ... technical triplicates were performed on 5 ng of cDNA using Takyon Low ROX SYBR 2X MasterMix blue dTTP (Eurogentec) on a ViiA™7 thermal cycler (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2022Quote: ... and then with FITC-labelled C-rich telomere probe (1:100 dilution of 5 nmol, PN-TC011-005, Eurogentec) in the dark at RT for 1.5 h ...
-
bioRxiv - Microbiology 2020Quote: ... or 500 ng to 3 µg for integrative plasmids (MicroPulserTM electroporator Biorad in 2 mm cuvettes (Eurogentec) at 25 µF ...
-
bioRxiv - Cell Biology 2021Quote: ... We amplified 4 µL cDNA (50 ng) using 10 µL of Takyon™ No Rox SYBR MasterMix Blue dTTP (Eurogentec, Liege, Belgium), 2 µL of each reverse and forward primers (10 mM) ...
-
bioRxiv - Biochemistry 2021Quote: ... 21T (5’ TTA-GGG-TTA-GGG-TTA-GGG-TTA-GGG-TT-TEG-biot) and scramble (5’ AAG-TGT-GTG-TGT-GTG-TGT-GTG-TGA-AG-TEG-biot) sequences were purchased from Eurogentec.
-
bioRxiv - Cell Biology 2021Quote: ... and washed with PBS before blocking and primary antibody incubation (mouse-anti 5-methycytosine, Eurogentec, BI-MECY-0100, 1:250). After PBS washes ...
-
bioRxiv - Cell Biology 2022Quote: ... with 5% non-fat dry milk for 30 min and incubated with anti-HA primary antibody (1:5,000, Eurogentec 16B12) or anti-Pgk1 primary antibody (1:5,000 ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was diluted 1:5 in water and μl used as template for qPCR using Mesa blue MasterMix Plus for SYBR (Eurogentec) and a CFXConnect Real-Time System (BioRad ...
-
bioRxiv - Microbiology 2021Quote: ... one-step qPCR assay was performed using 5 μL of RNA and Takyon Low rox one-step RT probe Mastermix (Eurogentec) and specific primers and probe targeting E gene ...
-
bioRxiv - Cell Biology 2022Quote: ... The metaphases were hybridized first with Cy3-labeled G-rich telomere probe (1:100 dilution 5 nmol, PN-TG050-005, Eurogentec) and then with FITC-labelled C-rich telomere probe (1:100 dilution of 5 nmol ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 30-bp complementary DNA fragments corresponding to the marRAB or acrAB marboxes with 5 nucleotides in each flank were purchased from Eurogentec (Seraing ...
-
bioRxiv - Molecular Biology 2022Quote: ... membranes were blocked in 5% milk PBS-T (1X PBS buffer with 0.1% Tween-20) and incubated overnight at 4°C with one of the following antibodies: anti-HA.11 (1:2,000; Eurogentec, Cat# MMS-101P-500), anti-Stm1 (1:10,000 ...
-
bioRxiv - Biophysics 2021Quote: Experiments based in the UK (CD, UV and FRET) were performed using oligonucleotides purchased from Eurogentec (PQS18-1 5′-[r(GGCUCGGCGGCGGA)]- 3 ′ PQS18-1DNA 5 ′ -[d(GGCTCGGCGGCGGA)]-3 ′ and PQS18-1FRET 5 ′ -[FAM-r(GGCUCGGCGGCGGA)-TAMRA]-3′) ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR was performed on a Applied Biosystems™ QuantStudio™ 5 Real-Time PCR System with SYBR Green PCR MasterMix (Eurogentec). Each reaction was performed on a 1:20 dilution of the cDNA ...
-
bioRxiv - Bioengineering 2022Quote: ... 3.75 μL of the appropriately diluted samples (ranging from 4 to 12.5-fold) were mixed with 7.5 μL of qPCR mastermix (MasterMix Plus for SYBR© Green I with fluorescein, Eurogentec, Liège, Belgium) in a final volume of 15 μL ...
-
bioRxiv - Microbiology 2021Quote: ... and the products were run on a 2% agarose gel at 100 V for 30 mins alongside the 100-1000 bp DNA Ladder (SmartLadder-SF, Eurogentec).
-
bioRxiv - Biochemistry 2023Quote: ... C+IVAPGEARLGSIKMA for bGIC-1 and C+TAAEGRISGMAIAKS for bGIC-2) were generated as a N-terminal Keyhole limpet haemocyanin fusion to raise the antibodies in rabbits (Eurogentec). For Western blots ...
-
bioRxiv - Microbiology 2024Quote: An amount of 2 μL of cDNA was then used for quantitative PCR with the MESA GREEN qPCR MasterMix Plus (Eurogentec) and primers for AID (Forward 5′ AATTCAAAAATGTCCGCTGGGC*T3′ ...
-
bioRxiv - Cancer Biology 2024Quote: ... Metaphases were denatured at 72°C in 70% formamide/30% 2xSSC solution for 2 min before hybridization to Alexa 488–OO-(CCCTAA)n probe (Eurogentec) at 37°C for 16 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... Relative copy numbers of the single-copy nuclear-encoded gene beta-2-microglobulin (β2M) and the mitochondrially-encoded gene mtND1 were measured by quantitative (Q)-PCR using SYBR Green Mastermix (Eurogentec Ltd.) and the DNA Engine Opticon 2 system (BioRad) ...
-
bioRxiv - Immunology 2020Quote: ... The expression of the genes of hexokinase 2 (HK2) and LDH-A was determined using PCR SYBR Green sequence detection system (Eurogentec, Seraing, Belgium) and the CFX Connect™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Physiology 2019Quote: ... and each sample was run in triplicate with 2 µL of the diluted cDNA and 8 µL of master mix containing 1x qPCR MasterMix Plus Low ROX (Eurogentec, Liège, Belgium) or 1x TaqMan gene expression MasterMix (Thermo Fisher Scientific ...