Labshake search
Citations for Eurogentec :
101 - 126 of 126 citations for 6H 3 8a Ethanopyrrolo 1 2 a pyrazine 1 4 dione tetrahydro 3R 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: Experiments based in the UK (CD, UV and FRET) were performed using oligonucleotides purchased from Eurogentec (PQS18-1 5′-[r(GGCUCGGCGGCGGA)]- 3 ′ PQS18-1DNA 5 ′ -[d(GGCTCGGCGGCGGA)]-3 ′ and PQS18-1FRET 5 ′ -[FAM-r(GGCUCGGCGGCGGA)-TAMRA]-3′) ...
-
bioRxiv - Neuroscience 2020Quote: Tibialis anterior muscles were dissected into bundles and processed for immunofluorescence using a combination of rabbit anti-synaptophysin (Eurogentec, 1/50) and rabbit anti-neurofilament antibodies (Eurogentec ...
-
bioRxiv - Plant Biology 2022Quote: ... First-strand cDNAs were synthesized from 1 μg of total RNA in 20 μl final volume using an oligo-dT(18)-MN primer (Eurogentec, France) and the Omniscript RT kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... qPCR was performed in triplicates on cDNA (1:10 dilution) using Takyon™ No ROX SYBR 2X MasterMix blue dTTP (Eurogentec) and CFX Connect Real-Time System (Biorad) ...
-
bioRxiv - Developmental Biology 2021Quote: Polyclonal anti-uL11K3me3 antibodies were generated in rabbit using a peptide corresponding to the first 16 amino acids of uL11 with methylated lysine 3 [PPK(me3)FDPTEVKLVYLRC] (Eurogentec). The serum was first loaded on a uL11K3me3 peptide affinity column which allowed to retain anti-uL11K3me3 and anti-uL11 antibodies ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibody staining was carried out at room temperature for 1 hour with custom made AOX antibodies (Eurogentec; Peptide: 1911009, Rabbit 237), diluted to 1:1000 ...
-
bioRxiv - Biochemistry 2023Quote: ... Membranes were then overnight incubated at 4°C with the anti-HA primary antibody (OptimAb HA. 11, Eurogentec), which was raised from mouse serum ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.3 mg of protein was used per rabbit for immunization of 2 rabbits (Eurogentec). Serum collected from one rabbit was affinity purified against GST-ATI11-180 ...
-
bioRxiv - Neuroscience 2021Quote: ... aiming to skip DMD exon 51 (51-[T*C*A*A*G*G*A*A*G*A*T*G*G*C*A*T*T*T*C*T]-3⍰, Eurogentec, Belgium) by transfection with Lipofectamine as described in43,44 and analysed by either myoblot (96 well plates ...
-
A quantitative tri-fluorescent yeast two-hybrid system: from flow cytometry to in-cellula affinitiesbioRxiv - Biochemistry 2019Quote: ... HA tagged proteins were labeled overnight at 4°C with the mouse HA.11 Clone 16B12 Monoclonal Antibody (Eurogentec) 1/2000 in PBS + tween 0.2% (v/v ...
-
bioRxiv - Genomics 2022Quote: Antibodies against H2A.Z.11 (KGLVAAKTMAANKDKC) and H2A.2 (CPKKAGSSKPTEED) peptides were raised in rabbits (Eurogentec) and purified by peptide affinity column ...
-
bioRxiv - Genomics 2023Quote: Antibodies against H2A.Z.11 (KGLVAAKTMAANKDKC) and H2A.2 (CPKKAGSSKPTEED) peptides were raised in rabbits (Eurogentec) and purified by a peptide affinity column ...
-
bioRxiv - Microbiology 2019Quote: An MHC I class-restricted peptide from YFV-17D non-structural protein 3 (NS3) (sequence ATLTYRML) (57) was synthetized by Eurogentec (Seraing, Belgium). Total cellular antigen for YFV-17D and JEV SA14-14-2 was prepared first by infecting Vero E6 cells with 0.1 MOI YFV-17D or JEV SA14-14-2 ...
-
bioRxiv - Plant Biology 2024Quote: ... 4 µl of the diluted cDNA was used together with Takyon No Rox SYBR MasterMix dTTP Blue (Eurogentec, Seraing, Belgium). AT3G01150 was chosen as reference gene (Czechowski et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... Capture antibodies were: our previously described custom rabbit anti-(GR)7 antibody (Eurogentec 2 µg/mL) 90 ...
-
bioRxiv - Microbiology 2023Quote: ... a 20 µl mixture containing 3 µl of RNA was prepared using the Low ROX One-Step qRT-PCR 2X MasterMix kit (Eurogentec®, Seraing, Belgium) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... A subset of fibers from passive and active experiments were prepared with one or more of the primary antibodies specific for various parts of I-band titin: PEVK (polyclonal IgG, custom-made; Eurogentec, Belgium, 1:500 in PBS), N2A (polyclonal IgG ...
-
bioRxiv - Cell Biology 2021Quote: ... We amplified 4 µL cDNA (50 ng) using 10 µL of Takyon™ No Rox SYBR MasterMix Blue dTTP (Eurogentec, Liege, Belgium), 2 µL of each reverse and forward primers (10 mM) ...
-
bioRxiv - Microbiology 2021Quote: ... and the products were run on a 2% agarose gel at 100 V for 30 mins alongside the 100-1000 bp DNA Ladder (SmartLadder-SF, Eurogentec).
-
bioRxiv - Biochemistry 2023Quote: ... C+IVAPGEARLGSIKMA for bGIC-1 and C+TAAEGRISGMAIAKS for bGIC-2) were generated as a N-terminal Keyhole limpet haemocyanin fusion to raise the antibodies in rabbits (Eurogentec). For Western blots ...
-
bioRxiv - Microbiology 2024Quote: An amount of 2 μL of cDNA was then used for quantitative PCR with the MESA GREEN qPCR MasterMix Plus (Eurogentec) and primers for AID (Forward 5′ AATTCAAAAATGTCCGCTGGGC*T3′ ...
-
bioRxiv - Cancer Biology 2024Quote: ... Metaphases were denatured at 72°C in 70% formamide/30% 2xSSC solution for 2 min before hybridization to Alexa 488–OO-(CCCTAA)n probe (Eurogentec) at 37°C for 16 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... Relative copy numbers of the single-copy nuclear-encoded gene beta-2-microglobulin (β2M) and the mitochondrially-encoded gene mtND1 were measured by quantitative (Q)-PCR using SYBR Green Mastermix (Eurogentec Ltd.) and the DNA Engine Opticon 2 system (BioRad) ...
-
bioRxiv - Immunology 2020Quote: ... The expression of the genes of hexokinase 2 (HK2) and LDH-A was determined using PCR SYBR Green sequence detection system (Eurogentec, Seraing, Belgium) and the CFX Connect™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Physiology 2019Quote: ... and each sample was run in triplicate with 2 µL of the diluted cDNA and 8 µL of master mix containing 1x qPCR MasterMix Plus Low ROX (Eurogentec, Liège, Belgium) or 1x TaqMan gene expression MasterMix (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... in a final volume of 10 µL (0.5 µL of each primer, 5 µL of Eurogentec Takyon™ SYBR® 2 x qPCR Mastermix Blue). The following Light-Cycler run protocol was used ...