Labshake search
Citations for Eurogentec :
51 - 82 of 82 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Real-time PCR was performed in a 20 μL final volume using the Takyon No Rox SYBR kit (Eurogentec). Fluorescence intensity was recorded using a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Developmental Biology 2024Quote: ... qRT-PCR was performed using Takyon Rox SYBR 2x Master mix blue dTTP kit (Eurogentec Cat# UF-RSMT-B0701), with starting concentrations of template of around 10ng/µl and primer concentrations of 0.5µM ...
-
bioRxiv - Plant Biology 2024Quote: ... Quantitative real-time PCR was performed at 60°C using Takyon No ROX SYBR 2X MasterMix blue dTTP (Eurogentec) in the LightCycler 480 (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was mixed in a qRT-PCR plate with MESA BLUE qPCR 2x MasterMix Plus for SYBR assay (Eurogentec) and qRT-PCR performed on a StepOnePlusTM real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR amplification was performed using MESA Green qPCR MasterMix for SYBR assay (Cat. No. RT-SY2X-03+WOUN, Eurogentec, Ltd.) on a DNA Engine Opticon2 thermocycler (BioRad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time (reverse transcriptase) PCR from cDNA was done with the Mesa Green qPCR Mastermix Plus for SYBR Assay-Low ROX (Eurogentec). For real time based quantification to study comparative differential expression here are list of primers that has been used ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative PCR was performed using primers listed in Table S2 and TakyonLow Rox SYBR MasterMix blue (Eurogentec #UF-LSMT-B0701). Samples were run on an ABI ViiA 7 cycler ...
-
bioRxiv - Plant Biology 2020Quote: ... which also contained 10 µl of the Power SYBR green PCR master mix of qPCR master mix plus for SYBR Green I (Eurogentec, Seraing ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative PCR was then performed using an ABI7500 Fast instrument and the MESA Green qPCR MasterMix Plus for SYBR assay (Eurogentec). Relative expression was calculated via the Pfaffl method79 using Gapdh and Polr2a as references gene ...
-
bioRxiv - Microbiology 2020Quote: ... Lentiviruses were titrated by SYBR green I-based real-time PCR-enhanced reverse transcriptase (SG-PERT) assay (29, 30) using the Takyon SYBR green kit (Eurogentec). The titer was determined by comparison with a standard curve of known RNA concentrations ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real-time (reverse transcriptase) PCR from cDNA was done with the Mesa Green qPCR Mastermix Plus for SYBR Assay-Low ROX (Eurogentec). 18s rRNA has been used as endogenous control.
-
bioRxiv - Developmental Biology 2022Quote: ... ChIP-qPCRs were carried out in a CFX96TM Real-Time PCR Detection System (Bio Rad) using TakyonTM No Rox SYBR MasterMix dTTP Blue (Eurogentec). Oligonucleotide primers used for ChIP-qPCR are listed in Supplementary Table 1.
-
bioRxiv - Microbiology 2021Quote: ... DNA eluted into 100 μl sample volume was tested in quantitative-PCRs (qPCRs) using primers and probes (Eurogentec, Seraing, Belgium) targeting sequences within metA ...
-
bioRxiv - Microbiology 2024Quote: An amount of 2 μL of cDNA was then used for quantitative PCR with the MESA GREEN qPCR MasterMix Plus (Eurogentec) and primers for AID (Forward 5′ AATTCAAAAATGTCCGCTGGGC*T3′ ...
-
bioRxiv - Plant Biology 2023Quote: Each quantitative PCR reaction was performed in three technical replicates with Takyon™ SYBR® 2X qPCR Mastermix Blue (Eurogentec) in 384-wells plates with a total volume of 10 uL using Light Cycler 480 apparatus (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... All qRT-PCR assays were carried out in 96-well plates using MESA Blue qPCR MasterMix Plus for SYBR Assay (Eurogentec). Primers for viral genes are shown in Table 1 ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples cDNA were mixed in a qRT-PCR plate with MESA BLUE qPCR 2X MasterMix Plus for SYBR Assay (Eurogentec) that contained the appropriate target primer mix (ratio ...
-
bioRxiv - Cell Biology 2024Quote: ... complementary DNA were diluted 1/20 for quantitative PCR (qPCR) reactions using Mesa green qPCR Master Mix (Eurogentec, Angers, France). PCR was conducted using the Mx 3000P real-time PCR system (Stratagene ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was used for real-time PCR analysis using Takyon Low Rox Probe 2x Master Mix dTTP Blue (Eurogentec, Liège, Belgium) with TaqMan® Assay-on-demand kits (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: ... All qRT-PCR assays were carried out in 96-well plates using Takyon™ No ROX SYBR 2X MasterMix blue dTTP (Eurogentec). Primers for cellular and viral genes are shown in S1 table ...
-
bioRxiv - Developmental Biology 2022Quote: ... was performed in a CFX96™ Real-Time PCR Detection System (Bio Rad) using TakyonTM No Rox SYBR MasterMix dTTP Blue (Eurogentec). Expression levels were normalised to the reference genes At5G25760 and At4G34270 70 ...
-
bioRxiv - Plant Biology 2023Quote: Gene expressions were measured by mixing 4.3 µL of a 100 fold diluted cDNA suspension with 7.5 µL of MESA Blue 2X PCR MasterMix for SYBR Green Assays with fluorescein (Eurogentec, Liege, Belgium). The mix is complemented with 3 µL of primers according to the optimal concentration allowing an efficiency close to 100% and calculated in previous experiments ...
-
bioRxiv - Immunology 2020Quote: ... The expression of the genes of hexokinase 2 (HK2) and LDH-A was determined using PCR SYBR Green sequence detection system (Eurogentec, Seraing, Belgium) and the CFX Connect™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: ... A region of 168 base pairs on the PB2 protein was amplified by RT-PCR using custom primers (Table S6)(Eurogentec, Maastricht, Netherlands) and the QIAGEN OneStep RT-PCR Kit (Qiagen ...
-
bioRxiv - Immunology 2024Quote: ... The expression of the genes HIF-1α and LDH-A was determined using the PCR SYBR Green sequence detection system (Eurogentec, Seraing, Belgium) and the CFX Connect Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Physiology 2024Quote: ... Quantitative PCR was performed on a Bio-rad CFX96 apparatus using TakyonTM No ROX SYBR Mastermix blue dTTP (Eurogentec, UF-NSMT-B0701), 1/5 cDNA dilutions of the reverse transcription product and specific primer sets (Table S2) ...
-
bioRxiv - Cancer Biology 2024Quote: Real-time qPCR was performed on cDNA by using StepOnePlus™ Real-Time PCR System (Applied bioscience) and Takyon™ ROX SYBR 2X MasterMix dTTP blue (Eurogentec). For this test ...
-
bioRxiv - Molecular Biology 2022Quote: ... A 25 μl reaction volume was prepared for each reaction using the Low ROX One-Step qRT-PCR 2X MasterMix kit (Eurogentec®, Seraing, Belgium) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative PCR (qPCR) was performed on the synthesised cDNA using Takyon™ Low ROX SYBR®master mix ddTTP blue (Eurogentec Liège, Belgium). qPCR was performed in three technical replicates and a non-template control was included ...
-
bioRxiv - Microbiology 2023Quote: ... A 25 µl reaction volume was prepared for each reaction using the Low ROX One-Step qRT-PCR 2X MasterMix kit (Eurogentec®, Seraing, Belgium) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... a 20 µl mixture containing 3 µl of RNA was prepared using the Low ROX One-Step qRT-PCR 2X MasterMix kit (Eurogentec®, Seraing, Belgium) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... and mRNA expression assayed with a two-step real-time quantitative PCR assay with qPCR MasterMix Plus w/o UNG with SYBR® Green I No Rox (Eurogentec S.A, Seraing, Belgium) using a Lightcycler® 480 Instrument (Roche Applied Science ...