Labshake search
Citations for Eurogentec :
701 - 733 of 733 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and those with Hcp pooled and used to generate polyclonal antibodies (EuroGentec).
-
bioRxiv - Plant Biology 2020Quote: ... the membrane was incubated with a rabbit polyclonal antiserum raised against recombinant ATC (Eurogentec, Belgium) for 1 h ...
-
bioRxiv - Cell Biology 2020Quote: A PLA kit II (Eurogentec, Seraing, BE) was used according to the manufacturer’s instructions with slight modifications ...
-
bioRxiv - Plant Biology 2020Quote: ... NdhD3 (Eurogentec, Liége, Belgium), Flv2 ...
-
bioRxiv - Genomics 2020Quote: ... were obtained from Eurogentec along with the complementary oligonucleotide that allows construction of the synthetic linker (Supplemental table 1) ...
-
bioRxiv - Genomics 2020Quote: ... the three RNA oligonucleotides (Eurogentec) containing three different base modifications ...
-
bioRxiv - Genetics 2020Quote: ... The seven most optimal AONs were purchased from Eurogentec (Liège, Belgium) and dissolved in phosphate-buffered saline (PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA (200 ng) was reverse transcribed using Reverse Transcription Core Kit (Eurogentec). Real-time PCR was performed in a 20 μL final volume using the Takyon No Rox SYBR kit (Eurogentec) ...
-
bioRxiv - Cell Biology 2020Quote: ... Real-time PCR was performed in a 20 μL final volume using the Takyon No Rox SYBR kit (Eurogentec). Fluorescence intensity was recorded using a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Plant Biology 2020Quote: ... using Takyon ROX SYBR 2X MasterMix dTTP blue (Eurogentec) beginning with a step at 95°C for 3 min ...
-
bioRxiv - Genomics 2020Quote: ... and mRNA expression assayed with a two-step real-time quantitative PCR assay with qPCR MasterMix Plus w/o UNG with SYBR® Green I No Rox (Eurogentec S.A, Seraing, Belgium) using a Lightcycler® 480 Instrument (Roche Applied Science ...
-
bioRxiv - Cell Biology 2020Quote: ... N2A polyclonal anti-rabbit (custom-made by Eurogentec, Seraing, Belgium), PEVK polyclonal anti-rabbit (Myomedix ...
-
bioRxiv - Cell Biology 2020Quote: ... N2A (polyclonal IgG, custom-made; Eurogentec, Belgium, 1:400 in PBS), and T12 (monoclonal IgG ...
-
bioRxiv - Cell Biology 2020Quote: ... A subset of fibers from passive and active experiments were prepared with one or more of the primary antibodies specific for various parts of I-band titin: PEVK (polyclonal IgG, custom-made; Eurogentec, Belgium, 1:500 in PBS), N2A (polyclonal IgG ...
-
bioRxiv - Biophysics 2020Quote: ... Oligonucleotides (c-Myc and ds26; sequences = 5’-TGAGGGTGGGTAGGGTGGGTAA-3’ and 5’-CAATCGGATCGAATTCGATCCGATTG-3’, respectively) were purchased from Eurogentec, and dissolved in 10 mM lithium cacodylate buffer at pH 7.3 ...
-
bioRxiv - Cell Biology 2020Quote: ... ERRα siRNAs were from Eurogentec; ERR#1(GGCAGAAACCUAUCUCAGGUU) ...
-
bioRxiv - Cell Biology 2020Quote: Anti-TMEM70 antibodies were rabbit polyclonal sera raised by Eurogentec SA (Belgium ...
-
bioRxiv - Cell Biology 2020Quote: ... using the Takyon ROX SYBR 2X MasterMix (Eurogentec, Liege, Belgium). qRT-PCR was undertaken using gene-specific primers for DCN ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... were added by PCR using HGS Diamond Taq DNA polymerase (Eurogentec). The samples were purified and eluted in 35 μl of EB buffer (MinElute PCR Purification Kit ...
-
bioRxiv - Genomics 2020Quote: ... A snoRNA-specific forward primer and a universal reverse primer (RTQ-UNIR, matched to the Tm of each snoRNA) were used for the amplification of each target (all Eurogentec, Seraing, Belgium) (Primer sequences are in Supplementary File 1) ...
-
bioRxiv - Genomics 2020Quote: ... with 100 nM ASO (Eurogentec, Belgium) targeting SNORD26 or SNORD96A ...
-
bioRxiv - Biochemistry 2020Quote: ... Custom oligonucleotides (Eurogentec) used for cloning procedures are listed in Table S3 ...
-
bioRxiv - Microbiology 2020Quote: ... designed in our laboratory (Eurogentec). PCR amplification was done in a 20 μL volume including 15 μL of mix and 5 μL of extracted DNA ...
-
bioRxiv - Microbiology 2020Quote: ... Extracted DNA was incorporated into real-time PCR performed using Metha_16S_2_MBF: 5’-CGAACCGGATTAGATACCCG -3’ and Metha_16S_2_MBR: 5’-CCCGCCAATTCCTTTAAGTT-3’ primers (Eurogentec, Angers, France) and FAM_Metha_16S_2_MBP 6FAM-CCTGGGAAGTACGGTCGCAAG probe targeting the 16S DNA gene of methanogens ...
-
bioRxiv - Microbiology 2020Quote: ... polyclonal rabbit anti-aa40-59 JCPyV agno-sera (generated on request by Eurogentec, Belgium), polyconal anti-BKPyV agnosera (generous gift from C ...
-
bioRxiv - Microbiology 2020Quote: ... polyclonal rabbit anti-aa40-53 BKPyV agno-sera (generated on request by Eurogentec, clone 1163), polyclonal rabbit anti-BKPyV LTag sera (generous gift from C ...
-
bioRxiv - Microbiology 2020Quote: ... and an Alexa-647-labeled (Eurogentec) nonspecific probe non-EUB (5′-ACTCCTACGGGAGGCAGC) ...
-
bioRxiv - Immunology 2020Quote: ... The FITC-labelled GP61 peptide was custom made by Eurogentec.
-
bioRxiv - Immunology 2020Quote: ... qPCR assays were performed using primers purchased from Eurogentec (Seraing, Belgium; Table 1) and specific for the gene coding for the flaA and flaB subunit genes ...
-
bioRxiv - Developmental Biology 2020Quote: ... Oligonucleotides were purchased from Eurogentec and are detailed in the Supplementary material ...
-
bioRxiv - Biophysics 2020Quote: Oligonucleotides were purchased from Eurogentec (Seraing, Belgium) or IDT (Leuven ...
-
bioRxiv - Genetics 2020Quote: ... T4 (SIITFEKL) were purchased from Eurogentec or Peptides&Elephants.
-
bioRxiv - Genetics 2020Quote: ... and random probe (negative control) were adapted from Chu et al.’s paper 18 (sequences in “Supplementary file”) and manufactured by Eurogentec. The method is summarised as follows ...