Labshake search
Citations for Mirus Bio :
1 - 50 of 206 citations for Sulfur Free Cobalt Metallo Organic Standard Co @ 5000 µg g in Hydrocarbon Oil since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transfected with 1.5 µg of the pHR plasmid along with two plasmids containing the lentiviral packaging proteins (0.167 µg of pMD2.G and 1.3 µg of p8.91) with TransIT-293 (Mirus Bio). After 2–3 d of transfection ...
-
Adaptation of CD4 in gorillas and chimpanzees conveyed resistance to simian immunodeficiency virusesbioRxiv - Microbiology 2024Quote: ... and 0.2 µg of pC-VSV-G (VSV-G envelope) using a 3:1 ratio of TransIT-293 (Mirus) transfection reagent to DNA according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2023Quote: The DNA library was co-transfected with pCMV-dR8.91 and pMD2.G plasmids using TransIT-Lenti (Mirus) into HEK293 cells ...
-
bioRxiv - Systems Biology 2024Quote: Lentivirus was produced by co-transfecting LentiX™ 293T cells with transfer plasmids and standard packaging vectors (psPAX2, pMD2G) using TransIT-LTI Transfection Reagent (Mirus, MIR 2300). When required ...
-
bioRxiv - Cell Biology 2020Quote: ... pTRIPz or pLKO.1 plasmid was co-transfected with lentiviral Packaging vectors (pMD2.G and psPAX2) into HEK293T using TransIT-LT1 (Mirus) transfection reagent following the manufacturer instruction ...
-
bioRxiv - Microbiology 2024Quote: ... and 1 µg PMD2.G packaging plasmids using 25 µL TransIT-LT1 Transfection Reagent (Mirus, MIR 2306). After 72 h of transfection ...
-
Prom1 and Notch regulate ciliary length and dynamics in multiciliated cells of the airway epitheliumbioRxiv - Cell Biology 2022Quote: ... The VSV-G pseudotyped lentivirus was packaged by 5 plasmid co-transfection of HEK293T cells using TansIT Transfection Reagent (Mirus Bio) in 15 cm culture dishes (The protocol describing production of lentiviral particles can be found at http://www.www.bu.edu/dbin/stemcells/protocols) ...
-
bioRxiv - Biochemistry 2022Quote: ... Lentivirus transfer vectors were packaged by co-transfection with psPAX2 and pMD2.G (4:3:1) using TransIT-2020 (Mirus Bio) in HEK293T cells ...
-
bioRxiv - Genetics 2020Quote: ... shUBR5 and shScrambled-pLKO.1-puro were co-transfected with pCMV-VSV-G and pCMV-dR8.2 dvpr plasmids into HEK 293T cells using TransIT293 reagent (Mirus Bio LLC, USA). To generate stable silenced shUBR5 cells ...
-
bioRxiv - Cell Biology 2023Quote: ... and transfected with 1.5 µg of the indicated plasmid DNA and 0.5 µg of the PiggyBac transposase construct using TransIT-X2 (MIR6004, Mirus) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... 1.25 µg of pMD2.G and 0.625 µg of psPAX2 were inoculated to each well using Mirus transIT-X2 transfection reagent (Mirus). Culture medium was changed to fresh medium at 4∼24 hr post transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... and 20.5 µg pcDNA3.1 VSV-G in 4.9 ml DMEM with 345 µl TransIT-Lenti Transfection Reagent (Mirus Bio, MIR 6600) added to 4.8 ml DMEM ...
-
bioRxiv - Immunology 2023Quote: ... cells were co-transfected with TransIT-LT1 (Mirus) with a plasmid encoding a fully replication-competent lentivirus (IMCs) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cells were co-transfected (Mirus LT1 or Mirus X2) with uniform masses of dCasMINI-modulator- and sgRNA-expressing plasmids such that each well received a single modulator construct to be tested ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cells were co-transfected (Mirus LT1 or Mirus X2) with uniform masses of dCasMINI-modulator- and sgRNA-expressing plasmids such that each well received a single modulator construct to be tested ...
-
bioRxiv - Genomics 2021Quote: ... and the appropriate pLKO-derived vector (at ratios of 8 µg, 1 µg, and 8 µg, respectively, per 15 cm dish) with Trans-LT1 (Mirus Bio, Madison WI), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... were co-transfected using TransIT-Insect Transfection reagent (Mirus, MIR6105). Cells were harvested 48 hrs post-transfection and samples were processed and analyzed following the procedure described above.
-
bioRxiv - Biophysics 2023Quote: COS-7 cells were transfected with Trans-IT LT1 (Mirus) according to the manufacturer’s instructions and collected 48 h post-transfection ...
-
bioRxiv - Developmental Biology 2023Quote: ... COS-7 cells were transfected with Trans-IT LT1 (Mirus) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... and co-transfected to HEK293T cells using TransIT-293 (Mirus). 48 hours after transfection ...
-
bioRxiv - Microbiology 2022Quote: ... or 2 µg of pPol1II-HA and 2 µg of pPol1II-NA) using TransIT-293 (Mirus). Virus supernatant was harvested 72 hours post-transfection and filtered through 0.22 µm filters ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 µg/mL puromycin (Mirus). African green monkey Vero [ATCC CCL-81] and N2a ΔB4galt7ΔLDLR-TC LDLR (N2a ΔB4galt7-LDLR ...
-
bioRxiv - Neuroscience 2022Quote: ... COS-7 cells were transfected using TransIT-LT1 transfection reagent (Mirus). Cells are checked annually for mycoplasma contamination.
-
bioRxiv - Cell Biology 2022Quote: ... were co-transfected in 293T cells using TransIT-Lenti (Mirus Bio). Viral supernatants were collected at 48 hrs and 72 hrs after transfection and centrifuged at 1,000 g for 10 mins ...
-
bioRxiv - Immunology 2020Quote: ... and then co-transfected using TransIT-mRNA Transfection Kit (Mirus Bio) with a GFP-expressing mRNA plasmid (Miltenyi Biotec ...
-
bioRxiv - Cell Biology 2023Quote: ... Co-transfection of siRNA was performed with TransIT-X2 (Mirus Bio) and experiments perfomed 48 h later.
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid constructs were co- transfected with TransIT-293 (Mirus Bio) and 5 μg of each plasmid (pcDNA3.1 N- FLAG ...
-
bioRxiv - Cell Biology 2022Quote: ... and 0.2 µg of pVSVG) and 1.5 µg of lentiviral vector using TransIT-LT1 Transfection Reagent (Mirus). Lentiviral supernatant was harvested and filtered through a 0.45 µm PES filter.
-
bioRxiv - Bioengineering 2024Quote: ... Plasmids (1 µg transient or 0.5 µg integration) were transfected using TransIT-293 or TransIT-LT1 reagent (Mirus). After integration ...
-
bioRxiv - Molecular Biology 2022Quote: ... co-transfection in 293GP cells with TransIT-LT1 Transfection Reagent (Mirus, 2300). Two days later ...
-
bioRxiv - Bioengineering 2020Quote: ... cells were co-transfected using LT1 reagent and protocol (Mirus Bio, MIR2306) with a plasmid containing Cas9+NLS under the CMV promoter and a plasmid containing the guide RNA CACTCACGCAAAAGGCCAGCAGG under the U6 promoter ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... HEK-293T cells were co-transfected using TransIT-Lenti transfection reagent (Mirus, USA), with 500ng psPAX2 (addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... HEK293T cells were co-cultured with 15 μL of TransIT-LT1 (Mirus Bio) reagent and 5 μg of plasmids comprising sgRNA and packaging vectors PLP1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... reporter plasmid delivery (3 µg/plate for cFSHr and 0.3 µg/plate for cLHr) was carried out with TransIT-X2® System (Mirus). The cells were serum-starved for 16 h ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2μg pMD2.G using TransIT (Mirus). Viral supernatant was collected 48 and 72h after transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2μg pMD2.G using TransIT (Mirus). Viral supernatant was collected 48 and 72h after transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... pCMV-deltaR8.91 and pMD2.G-VSV-G into HEK293T cells using the TransIT-LT1 Transfection Reagent (Mirus Bio LLC). Virus-containing supernatants were collected 48 hr after transfection ...
-
bioRxiv - Developmental Biology 2021Quote: ... and co-transfected with pPB-Cas9-IN and pCAG-PBase using TransIT-LT1 (Mirus) followed by selection with 1µg/ml Puromycin and 300µg/ml G418 ...
-
bioRxiv - Cell Biology 2023Quote: ... and standard packaging vectors using the TransIT-LT1 Transfection Reagent (Mirus, MIR 2306). Supernatant was collected 48 hours post transfection ...
-
bioRxiv - Cancer Biology 2022Quote: All lentiviruses were produced by co-transfection of HEK 293T/17 cells with plasmid DNA for the respective lentiviral vector and the packaging components psPAX2 and pMD2.G at a 5:3:2 mass ratio (vector:psPAX2:pMD2.G) using TransIT-LT1 (Mirus MIR 2300). Lentiviral supernatants were collected at 48 and 72 hours post-transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... and rev genes and pMD2.G encoding the VSV-G envelope protein using the TransIT-Lenti transfection reagent (Mirus, MIR 6650). The virus was harvested after 48 hours and filtered through a 0.45 μm filter ...
-
bioRxiv - Cancer Biology 2023Quote: All lentiviruses were produced by co-transfection of HEK 293T/17 cells with plasmid DNA for the respective lentiviral vector and the packaging components psPAX2 and pMD2.G at a 5:3:2 mass ratio (vector:psPAX2:pMD2.G) using TransIT-LT1 (Mirus MIR 2300). Lentiviral supernatants were collected at 48 and 72 hours post-transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... mESCs were co-transfected with guide RNA and HDR vectors using TransIT-LT1 reagent (Mirus; according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... Transfection of COS-7 cells was performed with TransIT-X2 transfection reagent (Mirus Bio, US) according to manufacturer’s instructions 24 hours after cell seeding and at least 22 hours before fixation ...
-
bioRxiv - Immunology 2020Quote: ... recombinant replication-incompetent lentiviruses were produced by co-transfecting HEK293T cells using transIT-LT1 (Mirus) with pMD2.G and psPAX2 helper plasmids together with lentiCas9-Blast (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... The prepared cells were co-transfected using the TransIT®-Lenti transfection reagent (Mirus Bio) with MISSION® Genomics Lentivirus Packaging Mix (Mirus Bio ...
-
bioRxiv - Cell Biology 2024Quote: ... HeLa cells were co-transfected with both plasmids using TransIt-LT1 (Mirus Bio, Madison, WI) following manufacture’s instruction ...
-
bioRxiv - Developmental Biology 2024Quote: ... Overexpression constructs were introduced by co-transfection with Flp recombinase using LT1 transfection reagent (Mirus). Selected KH2-SETα and KH2-SETβ clones were expanded and maintained on low hygromycin (100 µg/mL) ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by 2.5 µl/µg TransIT-LT1 transfection reagent (Mirus). Control transfections were also performed ...
-
bioRxiv - Genomics 2023Quote: ... and pMD2.g (Addgen #122259) using TransIT-LT1 (Mirus) according to manufacturer instructions ...