Labshake search
Citations for Mirus Bio :
1 - 50 of 75 citations for Siglec 5 Human HEK293 His Flag Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... in which human ACE2 and TMPRSS2 are induced by tetracycline (HEK293-3P6C33 cells) with TransIT-LT1 Transfection Reagent (Mirus, Madison, WI, USA), following the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK293 cells were transfected with TransIT-293 (Mirus) according to manufacturer’s instructions with three plasmids ...
-
bioRxiv - Physiology 2021Quote: HEK293 cells were transiently transfected with TransIT-LT1 reagent (Mirus) with channel cDNA and hERG1a N-terminal domain cDNAs in a 2:1 ratio in co-expression experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... H1 plasmid library with the top 5 sgRNA per gene21 were transfected into HEK293s using the TransIT®-Lenti Transfection Reagent (Mirus, Cat. No. MIR 6606) along with third generation lentiviral packaging mix ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The plated HEK293 cells were transfected using TransIT DNA transfection reagent (Mirus) following the instructions supplied by the manufacturer and incubated until use ...
-
bioRxiv - Immunology 2023Quote: HEK293 cells were transfected using TransIT-293 transfection reagent (Mirus Bio LLC). For transient expression of human Siglec-5-GFP 80% confluent HEK293 in 8 well chamber slide (0.25 ml/well ...
-
bioRxiv - Cell Biology 2023Quote: ... and transfected into HEK293 cells (ECACC) using TransIT-293 (Mirus Bio LLC), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... transiently expressed in HEK293 cells using TransIT-293 transfection reagent (Mirus, Madison, WI), and characterized using whole-cell patch-clamp electrophysiology and single cell calcium microfluorimetry as described above.
-
bioRxiv - Neuroscience 2023Quote: HEK293 cells were transfected to produce lentiviral particles with TransIT-Lenti transfection reagent (Mirus) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA3.1 Flag-MAVS-C79F or pcDNA3.1-Flag-MAVS-CcardA expressing constructs using TransIT-LT1 transfection reagent (Mirus) before selection using 800µg/ml geneticin (G418 ...
-
bioRxiv - Cell Biology 2021Quote: U20S or HEK293 cells were transfected with the TransIT-XL reagent (Mirus Bio, Madison, WI) with PRK-TK-Neo plasmids encoding for ovalbumin-derived peptides with a signal sequence (MGGTAARLGAVILFVVIVGLHGVRG - based on the signal sequence of Human Herpes Virus 1 Glycoprotein D ...
-
bioRxiv - Immunology 2020Quote: HeLa cells were transfected using TransIT-HeLaMONSTER and HEK293 cells using TransIT-293 (both from Mirus). Cells after transfection were cultured both with and without ProS or HS in the medium ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Cell-free viruses were produced by transfection of HEK293 cells with pNL4-3 using TransIT-LT1 (Mirus) or Fugene HD (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... The CPER products were then directly transfected into HEK293-C34 cells using Trans IT LT-1 (Mirus). At 6 hours post-transfection ...
-
bioRxiv - Microbiology 2021Quote: ... The half of CPER product was transfected into IFNAR1-deficient HEK293 cells TransIT-LT1 transfection reagents (Mirus), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: HEK293 were transfected with pMTBS and pCS2-ST at ~80% confluence using TransIT-293 transfection reagent (Mirus). Cells were harvested for downstream applications 48 hours post-transfection.
-
bioRxiv - Microbiology 2019Quote: ... HEK293 cells (150 cm2 dish) were transfected with 6 μg of each protein-coding plasmid by using TransIT (Mirus). Cell lysis and elution were performed as described above ...
-
bioRxiv - Cell Biology 2022Quote: ... for transfection of HEK293 Flp-In T-REx cells and 2 ul Trans-IT-HeLa and 1.3 ul Monster (MIR 2900, Mirus) for HeLa Flp-In T-REx cells ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Viral stocks of NL43 were produced by transfection of HEK293 cells with the molecular clone plasmid using TransIT-LT1 (Mirus) transfection reagent ...
-
bioRxiv - Microbiology 2019Quote: ... NL4-3 and NL4-3(AD8) HIV viral stocks were produced by transfection of HEK293 cells with the molecular clone plasmids using TransIT-LT1 (Mirus) transfection reagent ...
-
bioRxiv - Microbiology 2020Quote: The CPER products (25 μl out of a 50 μl reaction volume) were transfected into HEK293-3P6C33 cells or BHK-21 cells with Trans IT LT-1 (Mirus), following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2023Quote: ... Lentiviruses for transduction of LTR-mCherry reporter and expression of HIV receptors (CD4, CXCR4, and CCR5) was generated by transfection of HEK293 cells using the Mirus TransIT transfection kit (Mirus). The resulting supernatant was cleared of debris by low-speed centrifugation (300g for 5 minutes ...
-
bioRxiv - Immunology 2021Quote: ... FLAG-p46ATIL or an EV control using TransIT-X2 (Mirus Bio). At 24h post transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... carrying the sequence of the gene to be over expressed and resistance to puromycin into 0.8×106 HEK293 cells in a 60 mm culture dish with 6 µl of TrasnIT (Cat. Nº: Mirus Bio. 293) containing 3 ml of complete media ...
-
bioRxiv - Cell Biology 2020Quote: Flag-Astrin constructs were transiently transfected into HEK293T cells using TransIT-LT1 transfection reagent (Mirus Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... CHO-S cells were transfected with VHH-Fc containing construct using the CHO Gro System (Mirus Bio, WI, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... GFP- and FLAG-tagged proteins under the control of the Actin promoter using TransIT-LT1 reagent (Mirus). 24-40 h after transfection ...
-
bioRxiv - Microbiology 2020Quote: ... 2.5µg of pCAGGS NA-FLAG (either NAg+ or NAg-) were transfected using 7.5µl of LT1-TransIT transfection reagent (Mirus). Twenty-four hours post transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... transfected with 9 μg HA-tagged and 9 μg Flag-tagged constructs using TransIT-LT1 transfection reagents (Mirus). The transfected cells were cultured for another two days ...
-
bioRxiv - Genomics 2019Quote: ... HEK293 cells were transfected with either 2.5 or 8 ug of the pCMV-Aire-Flag plasmid (or control plasmid) using 7.5 or 32 ul of the TransIT-293 transfection reagent (Mirus). After 48h ...
-
bioRxiv - Molecular Biology 2022Quote: ... samples were transfected with 5 μg of the indicated FLAG-tagged TTP wild-type or mutant expression plasmids using TransIT 293 reagent according to the manufacturer’s protocol (Mirus). 48 hours after transfection ...
-
bioRxiv - Genetics 2020Quote: ... Constructs containing FP-GRIP1-KBD +/- exon 21 and FLAG-BicD2-KIF5A were expressed by transfection using TransIT-LT1 (Mirus). Approximately 24 hours after transfection ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were transfected with the N-terminal FLAG-tagged CDC42 expression vector using TransIT 293 (Mirus Bio LLC) in 6-well culture plates ...
-
bioRxiv - Cell Biology 2022Quote: pQCXIH-SARS-CoV-1-ORF7a-FLAG and pQCXIH-SARS-CoV-2-ORF7a-FLAG were transfected to HEK293T cells with the packaging plasmids pMD.GagPol and pMD.VSVG using Trans-IT293 (Mirus Bio). Viral supernatants were collected 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: ... pcDNA6-SARS-CoV-2-ORF3a-FLAG and pcDNA6-SARS-CoV-2-ORF8-FLAG plasmids (kind gifts of Prof Peihui Wang, Shandong University, China) using a commercial liposome method (TransIT-LT1, Mirus). Transfection mixtures containing plasmid DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... expression in the indicated cell lines was induced with 1 μg/ml doxycycline and cells were transfected with a pcDNA3-SCAPER-FLAG construct using TransIT293 (Mirus) in 10 cm dishes ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 μL of TransIT-LT1 (Mirus), and the transfection was performed as per manufacturer’s directions ...
-
bioRxiv - Microbiology 2022Quote: ... were seeded into 6-well plates and transfected the next day with 200 ng pcDNA4/TO-RNR-3×FLAG using TransIT-LT1 (Mirus #2304). A3B-EGFP or A3A-EGFP expression was induced 6 hours after transfection with 50 ng/mL doxycycline ...
-
bioRxiv - Microbiology 2022Quote: Approximately 250,000 293T cells were seeded in 6-well plates and transfected the next day with 100 ng pcDNA5/TO-A3-EGFP and 200 ng pcDNA4/TO-RNR-3×FLAG using TransIT-LT1 (Mirus #2304). Cells were harvested ~24 hours after transfection and resuspended in 500 µl of lysis buffer (50 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells were grown on coverslips and transiently transfected with mCherry Parkin and PPP3CB-Flag using Trans-IT transfection reagent (Mirus Bio) for 18 h ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to the cells ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to cell monolayers ...
-
bioRxiv - Molecular Biology 2021Quote: ... Transient transfection of FLAG-NMNAT1 and FLAG-NMNAT2 constructs (see Supplemental Table 2) was performed at ∼60% confluence using TransIT®-LT1 transfection reagent (Mirus Bio, Madison, WI) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Human Alveolus Chips were transfected with plasmid DNA using the TransIT-X2 reagent (Mirus Bio). 3 ug of plasmid DNA and 6 ul TransIT-X2 reagent were constituted in 300 ul OPT-MEM before added to 3 ml chip flow medium ...
-
bioRxiv - Biochemistry 2021Quote: Human POLA1 (NP_058633.2) and POLA1Δ1-337 was cloned into the pOET1 transfer vector (Mirus Bio). Human PRIM1 (NP_000937.1) ...
-
bioRxiv - Physiology 2023Quote: We cloned the coding sequences of human TSHB and CGA into pLIVE vectors (Mirus Bio, Madison, WI) using a polymerase chain reaction (PCR ...
-
bioRxiv - Bioengineering 2022Quote: Transfection of human pancreatic MIA PaCa-2 and BxPC-3 cells was performed with TransIT-mRNA (Mirus Bio) according to the manufacturer’s instructions ...
-
Membrane integration and topology of RIFIN and STEVOR proteins of the Plasmodium falciparum parasitebioRxiv - Biochemistry 2019Quote: ... and 5 μl Trans-IT®LT-1 transfection reagent (Mirus, USA) for 20 min ...
-
bioRxiv - Systems Biology 2021Quote: ... torque teno virus hypothetical protein or human respirovirus 3 D protein were transfected into the cells using TransIT-LT1 (Mirus Bio) according to manufacturer’s protocol ...