Labshake search
Citations for Mirus Bio :
1 - 50 of 76 citations for Human Chemokine C X C Motif Receptor 5 CXCR5 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... we co-transfected the cells with 50 ng of pMIR-REPORT constructs containing the 3’UTR sequences together with 50 ng of a Renilla housekeeping control plasmid and 100 nM of miR-424 or miR-503 mimics or a miRNA negative control (Dharmacon #C-300717-05, #C-300841-05, or #CN-001000-01-05, respectively) using the TransIT-X2 reagent (Mirus 6003). 24 hours after transfection ...
-
bioRxiv - Systems Biology 2021Quote: ... torque teno virus hypothetical protein or human respirovirus 3 D protein were transfected into the cells using TransIT-LT1 (Mirus Bio) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... cells were transfected with a plasmid encoding for SARS-CoV-2 S-glycoprotein (YP_009724390.1) harboring a C-terminal 19 aa truncation using TransIT-Lenti (Mirus Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 1.0 μg/well of the indicated receptors using TransIT-X2 transfection reagent (Mirus Bio); the total transfected DNA was normalized to 3.0 μg/well for all wells using empty pcDNA3.1 ...
-
bioRxiv - Microbiology 2019Quote: ... 100ng of RIG-I agonist derived from the 3’-UTR of hepatitis C virus (55) was transfected per 1e6 cells using TransIT-mRNA transfection kit (Mirus). For stimulation of MDA5 signaling ...
-
bioRxiv - Microbiology 2019Quote: ... 100ng of RIG-I agonist derived from the 3’-UTR of hepatitis C virus (19) was transfected per 1e6 cells using TransIT-mRNA transfection kit (Mirus). For stimulation of MDA5 signaling ...
-
bioRxiv - Developmental Biology 2020Quote: ... The HEK 293 cells were cultured at 37°C in DMEM media until they 80% confluency and transfected using TransIT®-LT1 Transfection Reagent (Mirus) at 37°C for 24h ...
-
bioRxiv - Immunology 2021Quote: ... were seeded in 10-cm2 dishes at a density of 5e6 cells per dish c and the following day transfected with 10 μg of spike expression plasmid with TransIT-Lenti (Mirus, 6600) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: 100 ug of pCMV6 plasmid was labeled with 55 ul of Cy5 Label-IT kit for 1 hour at 37°C (Mirus Bio, Madison, WI). The labeled plasmid was purified by ethanol precipitation ...
-
bioRxiv - Cell Biology 2021Quote: ... using the TransIT-X system (Mirus). Dual Luciferase Reporter assay (Promega ...
-
bioRxiv - Biochemistry 2024Quote: ... they were transfected with 1800 ng of plasmid containing either N- or C-terminal tagged GFP-AMPKγ3 using TransITx2 transfection reagent (Mirus Bio, cat no. MIR 6000) and then lysed 48 hours later (lysis buffer – 50 mM Tris ...
-
bioRxiv - Molecular Biology 2023Quote: ... whereas MEF cells used TransIT-X (Mirus) following manufacturer protocol with varied DNA concentrations ...
-
bioRxiv - Microbiology 2023Quote: ... Lentiviruses for transduction of LTR-mCherry reporter and expression of HIV receptors (CD4, CXCR4, and CCR5) was generated by transfection of HEK293 cells using the Mirus TransIT transfection kit (Mirus). The resulting supernatant was cleared of debris by low-speed centrifugation (300g for 5 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... which were transfected into Lenti-X 293T cells using TransIT-VirusGEN (Mirus MIR6700) according to the manufacturer’s instructions for a 12-well plate ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 μL of TransIT-LT1 (Mirus), and the transfection was performed as per manufacturer’s directions ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to the cells ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to cell monolayers ...
-
bioRxiv - Immunology 2021Quote: Human Alveolus Chips were transfected with plasmid DNA using the TransIT-X2 reagent (Mirus Bio). 3 ug of plasmid DNA and 6 ul TransIT-X2 reagent were constituted in 300 ul OPT-MEM before added to 3 ml chip flow medium ...
-
bioRxiv - Biochemistry 2021Quote: Human POLA1 (NP_058633.2) and POLA1Δ1-337 was cloned into the pOET1 transfer vector (Mirus Bio). Human PRIM1 (NP_000937.1) ...
-
bioRxiv - Physiology 2023Quote: We cloned the coding sequences of human TSHB and CGA into pLIVE vectors (Mirus Bio, Madison, WI) using a polymerase chain reaction (PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 1 x 106 Jurkat cells expressing Strep-tagged ADAP1 or GFP were resuspended in 0.1 mL Mirusbio ingenio (Mirus, MIR50115) solution containing 2 μg of TF-responsive reporters driving Firefly luciferase (pGL3-3xAP1-luciferase (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... Retrovirus was produced by transfection of Lenti-X 293T cells with packaging constructs and viral expression vector using TransIT-293 (Mirus). Viral supernatant was harvested 48hr later transfection and filtered through a 0.45 μM filter ...
-
bioRxiv - Bioengineering 2022Quote: Transfection of human pancreatic MIA PaCa-2 and BxPC-3 cells was performed with TransIT-mRNA (Mirus Bio) according to the manufacturer’s instructions ...
-
Membrane integration and topology of RIFIN and STEVOR proteins of the Plasmodium falciparum parasitebioRxiv - Biochemistry 2019Quote: ... and 5 μl Trans-IT®LT-1 transfection reagent (Mirus, USA) for 20 min ...
-
bioRxiv - Genomics 2023Quote: ... and VSV-G envelope protein using TransIT®-LT1 Transfection Reagent (Mirus) with ViralBoost Reagent (Alstem ...
-
bioRxiv - Molecular Biology 2021Quote: The pBR43IeG-nef+-iRFP670 vector was transfected either by itself or with VSV-G envelop plasmid (PMD2.G) into Lenti-X™ cells using Transit-X2 (Mirus Bio, LLC) to make XR-4 tropic or VSV-G pseudotyped HIV-iRFP virus respectively ...
-
bioRxiv - Molecular Biology 2024Quote: ... the transfer plasmid and helper plasmids VSV-G and PSP (generously provided by David Sanders) were transfected into the Lenti-X cells using Transit293 transfection reagent (Mirus, Cat. No. MIR 2700) and incubated in OptiMEM (ThermoFisher Cat No ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNAs encoding green fluorescent protein (GFP) were complexed with TransIT (Mirus Bio, Madison, WI) according to the manufacturer’s instructions by diluting in EMEM without serum or antibiotics and incubating for 2-5 minutes ...
-
bioRxiv - Genomics 2022Quote: ... in HK-2 human proximal tubule cells at approximately 70% confluency in 96-well plates by using TransIT-2020 Reagent (Mirus, #5404), following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: Plasmid expressing HA-tagged human WFS1 was transfected into HeLa cells using TransIT-X2® Dynamic Delivery System (Mirus Bio; MIR 6000). After 24 hours ...
-
bioRxiv - Microbiology 2022Quote: ... in which human ACE2 and TMPRSS2 are induced by tetracycline (HEK293-3P6C33 cells) with TransIT-LT1 Transfection Reagent (Mirus, Madison, WI, USA), following the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg pre-miR-181a-1 were labeled with cy3 using Nucleic Acid Labeling Kit (Mirus) following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2019Quote: ... VSV-G pseudotyped lentiviral vectors were produced by transfection of human embryonic kidney cells (HEK293FT) with third-generation lentivirus plasmids using lipofection (Mirus TransIT®-293). Supernatant was collected 48 h after transfection and concentrated using ultrafiltration (Centricon Plus-20 PLGC centrifuge filter units).
-
bioRxiv - Cell Biology 2019Quote: ... Cells were transfected with 1.5µg of the pHR plasmid along with two plasmids containing the lentiviral packaging proteins (0.167µg of pMD2.G and 1.3µg of p8.91) with TransIT-293 (Mirus Bio). After 2-3 days of transfection ...
-
bioRxiv - Microbiology 2021Quote: ... Transient transfections for protein expression in 293T were performed with Transit-LT1 transfection reagent (Mirus Biotech) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... individual wells were transfected with plasmids encoding Venus fused BH3-proteins using TransIT-X2 reagent (Mirus). Non-transfected wells were treated with transfection reagent alone (no DNA added) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with 5 μg of pACT-GFP-actin using TransIT-Insect transfection reagent (Mirus Bio) and incubated for 2 d at 28°C in Grace’s media with 10% FBS and antibiotics (100 μg/ml penicillin/streptomycin and 0.25 μg/ml Amphotericin B) ...
-
bioRxiv - Biophysics 2023Quote: ... at a dye:basepair ratio 1:5 using the Mirus Label IT Nucleic Acid Labeling Kit (Mirus Bio).
-
bioRxiv - Genetics 2023Quote: ... resuspended in v3.1 medium supplemented with 2 μM thiazovivin and 5 μg/ml polybrene (Mirus, MIR 6620), transduced with the hDel-v1 or hDel-v2 lentiviral sgRNA library at a target infection rate of 25% ...
-
bioRxiv - Genetics 2023Quote: ... resuspended in v3.1 medium supplemented with 2 μM thiazovivin and 5 μg/ml polybrene (Mirus, MIR 6620), transduced with the hDel-v3 lentiviral sgRNA library at a target infection rate of 10% ...
-
bioRxiv - Developmental Biology 2021Quote: ... protein expression (15 ng/well) and target (4.5 ng/well) plasmids using TransIT-2020 Transfection Reagent (Mirus) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... GFP- and FLAG-tagged proteins under the control of the Actin promoter using TransIT-LT1 reagent (Mirus). 24-40 h after transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... The human AD293 and iPSC cell lines were transfected using the Mirus TransIT®-LT1 Transfection Reagent (Cat # MIR 2300, Mirus Bio LLC, Madison, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and 5 μg of pSBbi or pSBtet containing gene of interest using TransIT-LT1 transfection reagent (Mirus Bio), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transfected with 1.5 µg of the pHR plasmid along with two plasmids containing the lentiviral packaging proteins (0.167 µg of pMD2.G and 1.3 µg of p8.91) with TransIT-293 (Mirus Bio). After 2–3 d of transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... together with the packaging plasmids psPAX2 (UK1701) and pMD2.G (UK1700) at a 10:7.5:5 ratio using TransIT-293 reagent (Mirus). The supernatant containing the viral particles was collected 48 hrs after transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tacatgtatacagatttagccacgatatatgaacgcgctgggcgagtggaagggagaaacggctcgattactcaaatccctattctGacAatgcctaatA atggtaagttttggtatttggattataacacacctaatcattttaaagagagagaagacccatctaccttttcgagttgaagttattttgagaacacatc using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Cell Biology 2024Quote: ... the packaging plasmids psPAX2 (UK1701) and pMD2.G (UK1700) at 10:7.5:5 ratio using TransIT-293 Transfection Reagent (MIR2704, Mirus) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... HEK293 cells (150 cm2 dish) were transfected with 6 μg of each protein-coding plasmid by using TransIT (Mirus). Cell lysis and elution were performed as described above ...