Labshake search
Citations for Mirus Bio :
301 - 350 of 510 citations for B Cell Activating Factor BAFF TNFSF13B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2019Quote: ... Cells were grown to 70% confluence and transfected with TransIT-CHO Transfection Kit (Mirus Bio LLC, Madison, WI). Transfected cells were split the following day and grown in Ibitreat 15 u-Slide 8 well slides (Ibidi ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were transiently transfected with 500ng of total DNA and 1.5μl of Transit X2 (Mirus Bio, Madison, WI) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Monolayers of ∼ 8 × 105 BHK-T7 cells were co-transfected using TransIT-LT1 transfection reagent (Mirus Bio LLC) with 0.8 μg each of nine plasmid constructs representing the T1L reovirus genome plus a single parental or mutant pBacT7-S1 plasmid ...
-
bioRxiv - Cell Biology 2022Quote: ... 10g of plasmid DNA was transfected into 293T lentiviral packaging cells using LT1 transfection reagent (Mirus Bio LLC), and viral supernatants were collected ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were transfected with 7.7 µg of a plasmid expressing HA-tagged M polyprotein using TransIT-LT1 (Mirus) and after 6 h the cells were treated with either DMSO or 1 µM ponasterone A (Pon A) ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were transfected with 2 μg of DNA 24 - 48 hours before measurement using TransIT transfection reagents (Mirus). DRG neurons from adult (postnatal weeks 8–12 ...
-
bioRxiv - Microbiology 2022Quote: A549 or 293T cells were reverse transfected with 25 nM siRNA (SMARTpool, Horizon) using siQuest or X2 (Mirus) in 96-well plates for 48 h ...
-
bioRxiv - Neuroscience 2023Quote: ... The striatal cells were then subjected to electroporation (AMAXA nucleofector I: program 05) in a buffer (Mirus Bio) along with plasmid (2ug plasmid per 2 million cells) ...
-
bioRxiv - Biochemistry 2023Quote: ... MCF10A cells were treated with an additional 750 μL of medium containing 3 μM puromycin (Mirus Bio 5940), achieving a final concentration of 1 μM (0.5 μg/mL ...
-
bioRxiv - Microbiology 2024Quote: Plasmids encoding the barcoded viral genomes were transfected into 293T cells using TransIT-LT1 (Mirus Bio, Madison, WI), and incubated for 48 h at 37°C ...
-
bioRxiv - Microbiology 2024Quote: HEK293T cells seeded in a 10 cm dish were transfected using TransIT-293 (Mirus Bio, Madison, WI, USA) with 670 ng pCAGGS-GP ...
-
bioRxiv - Microbiology 2024Quote: ... cells were transfected in triplicate with 12.5 ug total of pcDNA3 or pcDNA3-FLg50 using TransIT LT1 (Mirus) per manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pMIG-luciferase-IRES-GFP was produced by transfection of 293T cells with TransIT-293 (Mirus Bio, Madison, WI), lentiviral backbone as well as packaging vectors Δ8.9 (gag/pol ...
-
bioRxiv - Immunology 2021Quote: HEK 293T cells (106) were transfected in 6-well plates with corresponding plasmids with Transit LT1 transfection reagent (Mirus) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: Preadipocytes were transfected by seeding 30 000 cells per well of a 24 well plate in growth medium and adding 1.5 μl TransIT-X2 (Mirus) and 125 ng plasmid DNA or 1.4 μl LNA (10 μM ...
-
bioRxiv - Microbiology 2019Quote: ... HEK293 cells (150 cm2 dish) were transfected with 6 μg of each protein-coding plasmid by using TransIT (Mirus). Cell lysis and elution were performed as described above ...
-
bioRxiv - Microbiology 2019Quote: ... Plasmids containing each of the 10 viral cDNA’s and pCAG FAST P10 plasmid were transfected into BHK-T7 cells using TransIT-LT1 (Mirus)29 ...
-
bioRxiv - Cancer Biology 2020Quote: Lentivirus was produced in a 6cm2 dish by transient transfection of HEK293T cells using 18μL TransIT-LT1 (Mirus, MIR2304) in 150-170μL Opti-MEM reduced serum medium (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... BHK-21 cells were transfected with 500 ng of ACE2 or empty vector (pDISPLAY) using TransIT-X2 (Mirus Bio) according to the manufacturer’s recommendation ...
-
bioRxiv - Cancer Biology 2021Quote: ... vCas9-4T1 cells were transfected with crRNA and tracrRNA according the manufactures protocol using TransIT-X2 transfecting reagent (Mirus) in 12 well plates ...
-
bioRxiv - Microbiology 2021Quote: A549 ZAP−/−/− and DF-1 cells were cultured in 10 cm dish and transfected using LT1 reagent (Mirus lab) with 5 μg of huZAP-GFP DNA for 24 h ...
-
bioRxiv - Microbiology 2021Quote: ... The pTM plasmids were transfected into H7-T7-IZ cells using TransIT®-LT1 Transfection Reagent (Mirus Bio LLC) following the manufacturer’s recommendations with a ratio ADN to transfection reagent of 1 to 3.
-
bioRxiv - Microbiology 2021Quote: ... Wild-type/mutant MeV-M bearing a FLAG-tag and NiV-M bearing an HA-tag were cloned into pCMV and pcDNA3.1 respectively and transfected into cells using TrasnIT-LT1 transfection reagent (Mirus). VLPs were harvested 24 hours post-transfection ...
-
bioRxiv - Microbiology 2019Quote: ... Murine CD300lf and CD300ld (pcDNA3.4) were transiently transfected into HeLa cells with Trans-It LT1 (Mirus Bio, Madison, WI) according to manufacturer instructions15 ...
-
bioRxiv - Cell Biology 2022Quote: ... for transfection of HEK293 Flp-In T-REx cells and 2 ul Trans-IT-HeLa and 1.3 ul Monster (MIR 2900, Mirus) for HeLa Flp-In T-REx cells ...
-
bioRxiv - Cancer Biology 2020Quote: Lentivirus was generated by transfecting HEK39T cells with standard packaging vectors using TransIT®-LT1 Transfection Reagent (Mirus Bio). Viral supernatant was harvested 2-3 days after transfection and filtered through 0.44 µm PVDF filters and/or frozen prior to transduction.
-
bioRxiv - Microbiology 2022Quote: ... purified replicon RNA was transfected into HeLa cells grown on 96 well plates using TransIT mRNA transfection reagent (Mirus), and the cells were incubated in the growth medium supplemented with 5µM of cell-permeable Renilla luciferase substrate EnduRen (Promega ...
-
bioRxiv - Immunology 2019Quote: Viral particles were produced by transfection of HEK293FT cells in 6-well plates with 3µg DNA and 8µl TransIT-293 (Mirus Bio) per well ...
-
bioRxiv - Microbiology 2019Quote: ... HEK 293 cells were transfected with YF-NS1-GFP using TransIT®-LT1 transfection reagent (Mirus Bio LLC, Belgium), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... adherent Sf21 cells were transfected with plasmids expressing ARIF-1 using TransIT-Insect transfection reagent (Mirus Bio, Madison, WI). At 3 d post-transfection ...
-
bioRxiv - Immunology 2021Quote: ... The obtained recombinant vector was transfected into CHO-S cells using CHOgro High Yield Expression System (Mirus Bio, USA). The culture supernatant containing the RBD protein was harvested after 10 days ...
-
bioRxiv - Immunology 2022Quote: Viral particles were produced by transfection of HEK293FT cells in 6-well plates with 3μg DNA and 8μL TransIT-293 (Mirus Bio) per well ...
-
bioRxiv - Cancer Biology 2021Quote: ... pCMV-deltaR8.91 and pMD2.G-VSV-G into HEK293T cells using the TransIT-LT1 Transfection Reagent (Mirus Bio LLC). Virus-containing supernatants were collected 48 hr after transfection ...
-
bioRxiv - Immunology 2021Quote: ... Retroviral particles were produced by transfection of Platinum E (PLAT-E) cells with the TransIT-LT1 transfection reagent (Mirus) in Opti-MEM I reduced serum medium ...
-
bioRxiv - Immunology 2020Quote: ... Bare mRNA encoding CH505 M5 gp160 Envs were transfected at 0.5 μg/million cells using TransIT-mRNA Transfection Kit (Mirus). Transfected cells were harvested 48 hr post transfection ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were transfected with the N-terminal FLAG-tagged CDC42 expression vector using TransIT 293 (Mirus Bio LLC) in 6-well culture plates ...
-
bioRxiv - Immunology 2022Quote: ... CHO-S cells were transfected with VHH-Fc containing construct using the CHO Gro System (Mirus Bio, WI, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Zoology 2022Quote: ... Four µg of either plasmid were transfected into 6 × 105 C6/36 cells using TransIT-2020 transfection reagent (Mirus) for 4 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... were packaged in HEK 293T cells as previously described [15] using Turbofect (Fisher, UK) or trans-IT (Mirus. USA) as lipofection reagents ...
-
Ribosomal quality control factors inhibit repeat-associated non-AUG translation from GC-rich repeatsbioRxiv - Molecular Biology 2023Quote: ... T7 synthesized mRNA was transfected in cells at 70-80% confluency with TransIT-mRNA Transfection Kit (Mirus, MIR 2256) following the manufacturer’s recommended protocol ...
-
bioRxiv - Cell Biology 2022Quote: pQCXIH-SARS-CoV-1-ORF7a-FLAG and pQCXIH-SARS-CoV-2-ORF7a-FLAG were transfected to HEK293T cells with the packaging plasmids pMD.GagPol and pMD.VSVG using Trans-IT293 (Mirus Bio). Viral supernatants were collected 48 hours after transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tacatgtatacagatttagccacgatatatgaacgcgctgggcgagtggaagggagaaacggctcgattactcaaatccctattctGacAatgcctaatA atggtaagttttggtatttggattataacacacctaatcattttaaagagagagaagacccatctaccttttcgagttgaagttattttgagaacacatc using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentiviral cell lines were selected with hygromycin (Thermo 10687010, 250 μg/mL) and puromycin (Mirus MIR5940, 10 μg/mL). CT or HLH* EIF3A was cloned into nLV103-hygro ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK cells were transfected with TCR expression vector and lentiviral transfer plasmids using TransIT-VirusGen Transfection Reagent (Mirus #MIR6700) following the manufacturer’s recommendation ...
-
bioRxiv - Systems Biology 2023Quote: ... 500 ng of dCasMINI constructs and 250 ng of sgRNA constructs were transfected to the reporter cell line using 2.5 uL of TransIT-LT1 (Mirus) in 100 ul of Opti-MEM reduced serum media (Thermo Fisher).
-
bioRxiv - Cancer Biology 2023Quote: ... Control and BCAT1-KO U251 cells were reverse-transfected with 1µg/ml of TC3-R9P-3NLS pDNA using 1:2 of Trans-iT (Mirus). 48h after transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... plasmids were transfected in duplicate into HEK293T cells in a 48-well plate using LT-1 transfection reagent (Mirus) with the indicated plasmids ...
-
bioRxiv - Cell Biology 2023Quote: ... and gRNA plasmids for targeting PRKAA1 and PRKAA2 were co-transfected into cells with TransIT-LT1 (Mirus, MIR 2305) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and the plasmid was transfected into the cells expressing tagged AP1G1 using a TransIT-HeLaMONSTER kit (Mirus Bio LLC), according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Viral stocks of NL43 were produced by transfection of HEK293 cells with the molecular clone plasmid using TransIT-LT1 (Mirus) transfection reagent ...