Labshake search
Citations for Mirus Bio :
1 - 50 of 195 citations for Aldosterone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: H1 control AC16 cardiomyocytes and cGAS KO AC16s were seeded in 12-well plates and transfected with 5 mg of CT-DNA using Transit X2 (Mirus) at a 2:1 ratio for 8 h prior to harvest ...
-
bioRxiv - Microbiology 2022Quote: ... The final CPER product was transfected into Vero E6-TMPRSS2 cells seeded into 6-well plates (~ 5 × 105 cells per well) by using the TransIT-X2 Dynamic Delivery System (Mirus Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg pre-miR-181a-1 were labeled with cy3 using Nucleic Acid Labeling Kit (Mirus) following the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... at a dye:basepair ratio 1:5 using the Mirus Label IT Nucleic Acid Labeling Kit (Mirus Bio).
-
bioRxiv - Biochemistry 2022Quote: ... BHK-21 cells cultured in 12-well plates were transfected with 3 μg capped in vitro transcribed DENV2 RNAs using the TransIT-mRNA transfection kit (Mirus Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: Cells were seeded in 96-well plates one day before transfection with TransIT-PRO transfection kit (Mirus Bio, Madison, WI, US) according to manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... Huh7 cells in 6- well plates were transfected with 3 μg of each in vitro transcribed RNA using the TransIT mRNA transfection kit (Mirus Bio) as previously described (33) ...
-
bioRxiv - Molecular Biology 2020Quote: ... MEF cells were grown in 6-well plates to 80% confluency before transfection with RP-sgRNA11204G (1.5ug/well) using TransIT®-mRNA Transfection Kit (Mirus Bio LLC). After 24h post transfection ...
-
bioRxiv - Microbiology 2023Quote: ... 500 ng of viral genomic RNA was transfected per well in 12-well plates through the TransIT®-mRNA Transfection Kit (Mirus Bio) following manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... using TransIT reagent (0.25 µl/well, 96-well plate, and 1 µl/well, 48-well plate, Mirus Bio). The transfection mix was replaced with fresh medium after 4 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... reporter plasmid delivery (3 µg/plate for cFSHr and 0.3 µg/plate for cLHr) was carried out with TransIT-X2® System (Mirus). The cells were serum-starved for 16 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 μL of TransIT-LT1 (Mirus), and the transfection was performed as per manufacturer’s directions ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to the cells ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to cell monolayers ...
-
bioRxiv - Cancer Biology 2022Quote: ... in 6-well plates by using TransIT-293 transfection reagent (Mirus #MIR2705) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... 106 HEK293T cells seeded in 100mm plates were cotransfected (TransIT, Mirus BIO 2700) with 6.5 µg of psPAX2 (Addgene 12260) ...
-
bioRxiv - Synthetic Biology 2021Quote: Transfection of constructs was performed in 12-well plates using TransIT-LT1 reagent (Mirus) with 1 μg DNA split evenly among plasmids used in each transfection ...
-
bioRxiv - Immunology 2021Quote: ... Retroviruses were packaged in PlatE cells by transient transfection using TransIT 293 (Mirus Bio) or Lipofectamine 3000 (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2022Quote: Cells were plated on 96 well plates and transfected using the TransIT-X2 (Mirus) transfection reagent with 0.075 µg DNA per well according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: Ptch1−/− MEFs were seeded in 24-well plates and transfected using TransIT-X2® (Mirus) and Opti-MEM reduced serum media (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were seeded into 96-well plates the day before transfecting with TransIT Pro (Mirus). Transfections were performed using 10ng/well of firefly expression plasmid and 5ng/well of PUb-RL Renilla luciferase normalization control plasmid (17) ...
-
bioRxiv - Cell Biology 2024Quote: ... and PEX19 sgRNAs were transfected in 96-well plates by lipofectamine (TransIT LT-1, Mirus). A normalized 55 ng of total plasmid DNA was used at a ratio of 50:5 TOPFlash/FOPFlash:Renilla ...
-
Membrane integration and topology of RIFIN and STEVOR proteins of the Plasmodium falciparum parasitebioRxiv - Biochemistry 2019Quote: ... and 5 μl Trans-IT®LT-1 transfection reagent (Mirus, USA) for 20 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... or Gqi5 reporter plasmid (3 μg/plate) was carried out with TransIT-X2® System (Mirus). The cells were serum-starved for 16 h ...
-
bioRxiv - Immunology 2021Quote: ... U2OS-STING cells plated in 12-well plates were transiently transfected using TransIT®-2020 (Mirus) with 500 ng of ATAD3A WT ...
-
bioRxiv - Genomics 2023Quote: ... on Matrigel (Corning)-coated plates using a reverse transfection method and Mirus TransIT-LT1 reagent (Mirus Bio, Madison, WI) and transfected cells were transiently selected for puromycin resistance ...
-
bioRxiv - Bioengineering 2022Quote: ... The vectors were transfected into A549 cells in 96-well microtiter plate using TransLT transfection reagent (Mirus) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... 0.08 million cells/well were seeded in a 24 well plate and transfected with TransIT-293 (Mirus) with 0.5µg/well of either pTRIP-SFFV-Hygro-2A-mScarlet ...
-
bioRxiv - Immunology 2021Quote: HEK 293T cells (106) were transfected in 6-well plates with corresponding plasmids with Transit LT1 transfection reagent (Mirus) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: Preadipocytes were transfected by seeding 30 000 cells per well of a 24 well plate in growth medium and adding 1.5 μl TransIT-X2 (Mirus) and 125 ng plasmid DNA or 1.4 μl LNA (10 μM ...
-
bioRxiv - Microbiology 2021Quote: ... monolayers of BHK-T7 cells (4 × 105) cultured in 12-well plates were co-transfected using 2.5 μL of TransIT-LT1 transfection reagent (Mirus) per microgram of DNA plasmid ...
-
bioRxiv - Biophysics 2021Quote: ... monolayers of BHK-T7 cells (4 × 105) cultured in 12-well plates were co-transfected using 2.5 μL of TransIT-LT1 transfection reagent (Mirus) per microgram of DNA plasmid ...
-
bioRxiv - Microbiology 2022Quote: ... monolayers of BHK-T7 cells (4×105) cultured in 12-well plates were co-transfected using 2.5 μl of TransIT-LT1 transfection reagent (Mirus) per microgram of DNA plasmid ...
-
bioRxiv - Microbiology 2022Quote: ... purified replicon RNA was transfected into HeLa cells grown on 96 well plates using TransIT mRNA transfection reagent (Mirus), and the cells were incubated in the growth medium supplemented with 5µM of cell-permeable Renilla luciferase substrate EnduRen (Promega ...
-
bioRxiv - Microbiology 2019Quote: ... monolayers of BHK-T7 cells (4 × 105) cultured in 12-well plates were co-transfected using 2.5 μL of TransIT-LT1 transfection reagent (Mirus) per microgram of DNA plasmid ...
-
bioRxiv - Immunology 2019Quote: Viral particles were produced by transfection of HEK293FT cells in 6-well plates with 3µg DNA and 8µl TransIT-293 (Mirus Bio) per well ...
-
bioRxiv - Microbiology 2020Quote: ... monolayers of BHK-T7 cells (4 × 105) cultured in 12-well plates were co-transfected using 2.5 μL of TransIT-LT1 transfection reagent (Mirus) per microgram of DNA plasmid ...
-
bioRxiv - Biochemistry 2021Quote: ... monolayers of BHK-T7 cells (4 × 105) cultured in 12-well plates were co-transfected using 2.5 μL of TransIT-LT1 transfection reagent (Mirus) per microgram of DNA plasmid ...
-
bioRxiv - Cancer Biology 2019Quote: ... Lentivirus expressing RIPK3 shRNA was generated by transfecting HEK-293T cells in 6 well plate with a 1: 0.1: 1 ratio of pMDG2: pVSVG: pLKO.1 with TransIT-LT1 transfection reagent (Mirus). After filtering through 0.45 μm of cellulose acetate membrane (VWR ...
-
bioRxiv - Immunology 2022Quote: Viral particles were produced by transfection of HEK293FT cells in 6-well plates with 3μg DNA and 8μL TransIT-293 (Mirus Bio) per well ...
-
bioRxiv - Immunology 2023Quote: 293T cells were seeded in 6-well plates at 0.2M cells/ml and were transfected with TransIT-LT1 (Mirus) 24h later with 1500 ng of empty plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... in a 12-well plate overnight and plasmids (1.5 μg) were transfected using 3 μl of TransIT-LT1 (Mirus). For IP experiments ...
-
bioRxiv - Biochemistry 2023Quote: ... plasmids were transfected in duplicate into HEK293T cells in a 48-well plate using LT-1 transfection reagent (Mirus) with the indicated plasmids ...
-
bioRxiv - Microbiology 2019Quote: ... HEK293 cells in 6 well plates were transfected with 500 ng/well of each protein-coding plasmid by using TransIT (Mirus). After 48 h ...
-
bioRxiv - Microbiology 2019Quote: ... in 24-well plates were transfected with 0.5 µg of plasmid DNA per well using TransIT-LT1 transfection reagent (Mirus Bio) in OptiMEM (Gibco) ...
-
bioRxiv - Microbiology 2019Quote: ... MHV68 was produced by first making p0 virus by transfecting NIH 3T3 cells in 6-well plates with 2.5 μg BAC DNA using TransIT-X2 (Mirus Bio) for 24h ...
-
bioRxiv - Cell Biology 2019Quote: ... 10cm-plate cultures of indicated cell lines were transfected/infected with indicated constructs using TransIT-Insect transfection reagent (Mirus, #MIR6100) for S2 cells ...
-
bioRxiv - Developmental Biology 2021Quote: ... E14 ESCs were nucleofected with 4ug linearized 2C-GFP plasmid and plated at low density in 10cm2 plates then selected with 250 μg/mLG418 (Mirus) for 8 days ...
-
bioRxiv - Cell Biology 2020Quote: ... Neuron progenitors were cultured on PO/LA coated plate and transfected with the RFP-LEPR carrying plasmid using the TransIT-Neural transfection reagent (Mirus) for 48 hours before leptin treatment ...