Labshake search
Citations for Mirus Bio :
1 - 50 of 55 citations for Adenovirus Type 5 Hexon Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... Transfections of wild-type and Gly1170Ser COL2A1-encoding plasmids were performed using Transit-2020 transfection reagent (Mirus) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... samples were transfected with 5 μg of the indicated FLAG-tagged TTP wild-type or mutant expression plasmids using TransIT 293 reagent according to the manufacturer’s protocol (Mirus). 48 hours after transfection ...
-
bioRxiv - Cell Biology 2020Quote: Transient DNA transfections of wild-type AP4B1 were carried out using a TransIT-HeLaMONSTER® kit (Mirus Bio LLC), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 μL of TransIT-LT1 (Mirus), and the transfection was performed as per manufacturer’s directions ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T-GFP cells were transiently transfected with wild-type and mutant spike plasmids using TransIT-X2 transfection reagent (Mirus #MIR 6000) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Molecular Biology 2021Quote: HEK293T-EGFP cells (donor cell) were transiently transfected with wild-type and mutant spike plasmids using TransIT-X2 transfection reagent (Mirus #MIR 6000). HEK293T-ACE2 and HEK293T (as a negative control ...
-
bioRxiv - Systems Biology 2021Quote: ... torque teno virus hypothetical protein or human respirovirus 3 D protein were transfected into the cells using TransIT-LT1 (Mirus Bio) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to the cells ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to cell monolayers ...
-
Membrane integration and topology of RIFIN and STEVOR proteins of the Plasmodium falciparum parasitebioRxiv - Biochemistry 2019Quote: ... and 5 μl Trans-IT®LT-1 transfection reagent (Mirus, USA) for 20 min ...
-
bioRxiv - Genomics 2023Quote: ... and VSV-G envelope protein using TransIT®-LT1 Transfection Reagent (Mirus) with ViralBoost Reagent (Alstem ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNAs encoding green fluorescent protein (GFP) were complexed with TransIT (Mirus Bio, Madison, WI) according to the manufacturer’s instructions by diluting in EMEM without serum or antibiotics and incubating for 2-5 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg pre-miR-181a-1 were labeled with cy3 using Nucleic Acid Labeling Kit (Mirus) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2019Quote: ... Cells were transfected with 1.5µg of the pHR plasmid along with two plasmids containing the lentiviral packaging proteins (0.167µg of pMD2.G and 1.3µg of p8.91) with TransIT-293 (Mirus Bio). After 2-3 days of transfection ...
-
bioRxiv - Microbiology 2021Quote: ... Transient transfections for protein expression in 293T were performed with Transit-LT1 transfection reagent (Mirus Biotech) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... individual wells were transfected with plasmids encoding Venus fused BH3-proteins using TransIT-X2 reagent (Mirus). Non-transfected wells were treated with transfection reagent alone (no DNA added) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with 5 μg of pACT-GFP-actin using TransIT-Insect transfection reagent (Mirus Bio) and incubated for 2 d at 28°C in Grace’s media with 10% FBS and antibiotics (100 μg/ml penicillin/streptomycin and 0.25 μg/ml Amphotericin B) ...
-
bioRxiv - Biophysics 2023Quote: ... at a dye:basepair ratio 1:5 using the Mirus Label IT Nucleic Acid Labeling Kit (Mirus Bio).
-
bioRxiv - Genetics 2023Quote: ... resuspended in v3.1 medium supplemented with 2 μM thiazovivin and 5 μg/ml polybrene (Mirus, MIR 6620), transduced with the hDel-v1 or hDel-v2 lentiviral sgRNA library at a target infection rate of 25% ...
-
bioRxiv - Genetics 2023Quote: ... resuspended in v3.1 medium supplemented with 2 μM thiazovivin and 5 μg/ml polybrene (Mirus, MIR 6620), transduced with the hDel-v3 lentiviral sgRNA library at a target infection rate of 10% ...
-
bioRxiv - Developmental Biology 2021Quote: ... protein expression (15 ng/well) and target (4.5 ng/well) plasmids using TransIT-2020 Transfection Reagent (Mirus) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... GFP- and FLAG-tagged proteins under the control of the Actin promoter using TransIT-LT1 reagent (Mirus). 24-40 h after transfection ...
-
bioRxiv - Microbiology 2023Quote: ... and 5 μg of pSBbi or pSBtet containing gene of interest using TransIT-LT1 transfection reagent (Mirus Bio), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transfected with 1.5 µg of the pHR plasmid along with two plasmids containing the lentiviral packaging proteins (0.167 µg of pMD2.G and 1.3 µg of p8.91) with TransIT-293 (Mirus Bio). After 2–3 d of transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... together with the packaging plasmids psPAX2 (UK1701) and pMD2.G (UK1700) at a 10:7.5:5 ratio using TransIT-293 reagent (Mirus). The supernatant containing the viral particles was collected 48 hrs after transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tacatgtatacagatttagccacgatatatgaacgcgctgggcgagtggaagggagaaacggctcgattactcaaatccctattctGacAatgcctaatA atggtaagttttggtatttggattataacacacctaatcattttaaagagagagaagacccatctaccttttcgagttgaagttattttgagaacacatc using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Cell Biology 2024Quote: ... the packaging plasmids psPAX2 (UK1701) and pMD2.G (UK1700) at 10:7.5:5 ratio using TransIT-293 Transfection Reagent (MIR2704, Mirus) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... HEK293 cells (150 cm2 dish) were transfected with 6 μg of each protein-coding plasmid by using TransIT (Mirus). Cell lysis and elution were performed as described above ...
-
bioRxiv - Microbiology 2020Quote: ... were transfected with 2·5 µg serine protease expression plasmid or empty vector using TransIT-X2 Dynamic Delivery System (Mirus). One day later ...
-
bioRxiv - Immunology 2022Quote: H1 control AC16 cardiomyocytes and cGAS KO AC16s were seeded in 12-well plates and transfected with 5 mg of CT-DNA using Transit X2 (Mirus) at a 2:1 ratio for 8 h prior to harvest ...
-
bioRxiv - Cell Biology 2022Quote: Plasmids for expression of kinesin-1 or any of the kinesin-6 family motors tagged with monomeric NeonGreen and an FRB domain were cotransfected into COS-7 cells with a plasmid for expression of PEX3-mRFP-FKBP or GMAP210p-mRFP-2xFKBP at a ratio of 5:1 with TransIT-LT1 transfection reagent (Mirus). Eighteen hours after transfection ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cells were transfected with 10 ug of the TRE library ± 5 ug of pcDNA3.1 containing a GPCR expression cassette using TransIT-2020 (Mirus Bio) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Medium was changed 24 h later to 10 ml of 5 % FBS/DMEM and changed again 48 h later to 10 ml of 5 % FBS/DMEM containing 1 µg/ml of puromycin (Mirus). Cells were incubated in selection medium for 72 h ...
-
bioRxiv - Microbiology 2019Quote: ... HEK293 cells in 6 well plates were transfected with 500 ng/well of each protein-coding plasmid by using TransIT (Mirus). After 48 h ...
-
Potassium channel-driven bioelectric signaling regulates metastasis in triple-negative breast cancerbioRxiv - Cancer Biology 2021Quote: ... Constructs were mixed with 0.5μg helper (encoding gag/pol) and 0.1μg encoding coat protein (pMD2) along with 6μL TransIT-Lenti transfection reagent (MIR6603; Mirus Bio; Madison, WI) in 200uL Opti-MEM (31985062 ...
-
bioRxiv - Microbiology 2020Quote: ... In vitro transcribed full-length CHIKV mRNA and mRNA encoding single viral proteins was transfected into target cells with the TransIT mRNA kit (Mirus). MAYV (strain TRVL15537 ...
-
bioRxiv - Immunology 2020Quote: HEK293T cells were transiently transfected with mRNA encoding SARS-CoV-2 WT S or S-2P protein using a TranIT mRNA transfection kit (Mirus). After 24 hr ...
-
bioRxiv - Systems Biology 2021Quote: ... and grown in complete media for 1 day before co-transfection of the mammalian expression vectors encoding GFP and viral protein of interest using TransIT-2020 transfection reagent (#MIR5404, Mirus). After 24 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Proteins were expressed in RPE1 or HeLa cells for 24–48 h using TransIT®-LT1 Transfection Reagent (Mirus Bio) or Neon Electroporation (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... Virus-like particles (VLPs) packaging Vpr WT or mutant proteins were generated by transient transfection of HEK 293T cells using TransIT-LT1 (Mirus). VLPs were harvested 48 hrs post transfection ...
-
Prom1 and Notch regulate ciliary length and dynamics in multiciliated cells of the airway epitheliumbioRxiv - Cell Biology 2022Quote: ... The VSV-G pseudotyped lentivirus was packaged by 5 plasmid co-transfection of HEK293T cells using TansIT Transfection Reagent (Mirus Bio) in 15 cm culture dishes (The protocol describing production of lentiviral particles can be found at http://www.www.bu.edu/dbin/stemcells/protocols) ...
-
bioRxiv - Microbiology 2020Quote: ... were seeded in 10-cm dishes at a density of 1e5 cells/cm2 and the following day transfected with 5 μg of spike expression plasmid with TransIT-Lenti (Mirus, 6600) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... were seeded in 10-cm dishes at a density of 1e5 cells/cm2 and the following day transfected with 5 μg of spike expression plasmid with TransIT-Lenti (Mirus, 6600) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: All lentiviruses were produced by co-transfection of HEK 293T/17 cells with plasmid DNA for the respective lentiviral vector and the packaging components psPAX2 and pMD2.G at a 5:3:2 mass ratio (vector:psPAX2:pMD2.G) using TransIT-LT1 (Mirus MIR 2300). Lentiviral supernatants were collected at 48 and 72 hours post-transfection ...
-
bioRxiv - Microbiology 2022Quote: ... The final CPER product was transfected into Vero E6-TMPRSS2 cells seeded into 6-well plates (~ 5 × 105 cells per well) by using the TransIT-X2 Dynamic Delivery System (Mirus Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: All lentiviruses were produced by co-transfection of HEK 293T/17 cells with plasmid DNA for the respective lentiviral vector and the packaging components psPAX2 and pMD2.G at a 5:3:2 mass ratio (vector:psPAX2:pMD2.G) using TransIT-LT1 (Mirus MIR 2300). Lentiviral supernatants were collected at 48 and 72 hours post-transfection ...
-
bioRxiv - Immunology 2022Quote: ... and NP proteins (23) were transfected into 50% confluent HEK293T cells in 6-well plates with TransIT-LT1 transfection reagent (Mirus Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... and packaging plasmids for expression of HIV-1 gag/pol and rev (+/-tat) and VSV-G envelope protein using either TransIT®-LT1 Transfection Reagent (Mirus) or Polyethylenimine (Polysciences ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were transfected with 250 ng of a pCDNA3.1(+) vector encoding for the SARS-CoV-2 spike protein using the TransIT®-LT1 Transfection Reagent (Mirus Bio). Six hours post transfection (p.t.) ...