Labshake search
Citations for Mirus Bio :
1 - 50 of 106 citations for 8 5 HEXYL 2 FURYL OCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg pre-miR-181a-1 were labeled with cy3 using Nucleic Acid Labeling Kit (Mirus) following the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... at a dye:basepair ratio 1:5 using the Mirus Label IT Nucleic Acid Labeling Kit (Mirus Bio).
-
bioRxiv - Genetics 2023Quote: ... resuspended in v3.1 medium supplemented with 2 μM thiazovivin and 5 μg/ml polybrene (Mirus, MIR 6620), transduced with the hDel-v1 or hDel-v2 lentiviral sgRNA library at a target infection rate of 25% ...
-
bioRxiv - Genetics 2023Quote: ... resuspended in v3.1 medium supplemented with 2 μM thiazovivin and 5 μg/ml polybrene (Mirus, MIR 6620), transduced with the hDel-v3 lentiviral sgRNA library at a target infection rate of 10% ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 8 µL of Trans-IT LT1 (Mirus, #2300) was added to Opti-MEM (Gibco ...
-
bioRxiv - Genomics 2021Quote: ... and the appropriate pLKO-derived vector (at ratios of 8 µg, 1 µg, and 8 µg, respectively, per 15 cm dish) with Trans-LT1 (Mirus Bio, Madison WI), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... were transfected with 2·5 µg serine protease expression plasmid or empty vector using TransIT-X2 Dynamic Delivery System (Mirus). One day later ...
-
bioRxiv - Cell Biology 2022Quote: ... using 8 μl of TransIT-293 (Mirus Bio #MIR 2705) transfection reagent per well ...
-
bioRxiv - Cancer Biology 2022Quote: All lentiviruses were produced by co-transfection of HEK 293T/17 cells with plasmid DNA for the respective lentiviral vector and the packaging components psPAX2 and pMD2.G at a 5:3:2 mass ratio (vector:psPAX2:pMD2.G) using TransIT-LT1 (Mirus MIR 2300). Lentiviral supernatants were collected at 48 and 72 hours post-transfection ...
-
bioRxiv - Cancer Biology 2023Quote: All lentiviruses were produced by co-transfection of HEK 293T/17 cells with plasmid DNA for the respective lentiviral vector and the packaging components psPAX2 and pMD2.G at a 5:3:2 mass ratio (vector:psPAX2:pMD2.G) using TransIT-LT1 (Mirus MIR 2300). Lentiviral supernatants were collected at 48 and 72 hours post-transfection ...
-
bioRxiv - Cell Biology 2021Quote: Biotin was covalently coupled to pDNA (pGL3 plasmid) by using Nucleic Acid Labeling Kit according to manufacturers’ protocol (Label IT® Nucleic Acid Labeling Kit, Biotin, Mirus Bio, USA). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... mtDNA was biotinylated with Label IT Nucleic Acid Labeling Kits (Mirus) and fragmented with HaeIII (New England Biolabs ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... n=8 wells) complexed with 6 μL TransIT-2020 transfection reagent (Mirus Bio; MIR 5404) at a final DNA concentration of 8 ng/uL in Advanced DMEM (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... 8×106 cells were suspended in 800 μl Ingenio® Electroporation Solution (Mirus Bio, Madison, WI) and mixed with 10 μg RNA in a 4-mm cuvette ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were either simultaneously seeded and transfected with various nucleic acids using Transit-X2 (Mirus), seeded and treated with IFN? 24 h later ...
-
bioRxiv - Cell Biology 2019Quote: ... 8 µg pCMV-dR8.91 and 1 µg pMD2.G packaging plasmids using 48 µl TransIT-LT1 (Mirus). Plasmid DNA was mixed with transfection reagent in Opti-MEM (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 μL of TransIT-LT1 (Mirus), and the transfection was performed as per manufacturer’s directions ...
-
bioRxiv - Microbiology 2020Quote: ... Monolayers of ∼ 8 × 105 BHK-T7 cells were co-transfected using TransIT-LT1 transfection reagent (Mirus Bio LLC) with 0.8 μg each of nine plasmid constructs representing the T1L reovirus genome plus a single parental or mutant pBacT7-S1 plasmid ...
-
bioRxiv - Immunology 2020Quote: ... self-RNA was labeled using a Label IT® Nucleic Acid Labeling Kit (Mirus cat. MIR7125), and Spermidine was labeled with 2-(methylamino ...
-
bioRxiv - Microbiology 2021Quote: ... was labelled with Cy5 by following manufacture’s protocol (Mirus Label IT Nucleic Acid Labeling Kit Cy5), diluted to 80 μg mL-1 in TE buffer ...
-
bioRxiv - Microbiology 2022Quote: ... or 2 µg of pPol1II-HA and 2 µg of pPol1II-NA) using TransIT-293 (Mirus). Virus supernatant was harvested 72 hours post-transfection and filtered through 0.22 µm filters ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Microbiology 2022Quote: ... or 2:2:1 (33) with TransIT®-LT1 transfection reagent (Mirus Bio LLC, Madison, WI, USA) and the plasmids ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfections were performed on 150 mm dishes (8 per condition) using Mirus TransIT®-LT1 Transfection Reagent (Mirus Bio) and Lipofectamine 2000 (Life Technologies) ...
-
bioRxiv - Molecular Biology 2022Quote: HDRT and xHDRT DNA were Cy5-labeled using the Label IT® Nucleic Acid Labeling Reagents (Mirus) and used in a standard nucleofection protocol (see Cas9 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL of Boost reagent (Mirus Bio) and 2 µL of TransIT mRNA reagent (Mirus Bio) ...
-
bioRxiv - Molecular Biology 2020Quote: BHK-21 cells were transfected in 25 cm2 flasks with 8 µg per flask of infectious clone-derived RNA using TransIT transfection reagent (Mirus) as described previously (32) ...
-
bioRxiv - Genomics 2021Quote: ... and pMD2.G at a ratio of 9:8:1 by mass using TransIT-LT1 transfection reagent (Mirus MIR 2306) at a ratio of 3 μL transfection reagent per 1 μg plasmid ...
-
bioRxiv - Developmental Biology 2023Quote: ... The dCas9-KRAB-mCherry plasmid was mixed with the pCMV_ΔR8.91 and pMD2.G packaging vectors at a ratio of 9:8:1 with TransIT®-Lenti Transfection Reagent (Mirus) in optiMEM (Gibco ...
-
bioRxiv - Molecular Biology 2024Quote: BHK-21 cells were transfected in 25 cm2 flasks with 8 µg per flask of infectious clone-derived RNA using TransIT transfection reagent (Mirus) as described previously (35) ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µg of PCR product was fluorescently labeled using the Label IT-Cy5 Nucleic Acid Labeling Kit (Mirus) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to the cells ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to cell monolayers ...
-
bioRxiv - Cell Biology 2022Quote: Viral particles were produced by transfection of 293FT cells in 6-well plates with 3 μg of total DNA and 8 mL TransIT-293 Transfection Reagent (Mirus Bio) per well ...
-
bioRxiv - Microbiology 2020Quote: Viral particles were produced by transfection of 293FT cells in 6-well plates with 3 μg DNA and 8 μl TransIT-293 Transfection Reagent (Mirus Bio) per well ...
-
bioRxiv - Immunology 2021Quote: ... transfected with 44 μg plasmid encoding SARS-CoV-2 Spike (pCG1-SARS-2-S, Wuhan Hu-1) using Transit LT-1 (Mirus). The next day ...
-
bioRxiv - Microbiology 2022Quote: ... 293T cells on 96-well plate were co-transfected with a set of pGS-AVLQS and pSARS-CoV-2 Mpro or a set of pGS-RLKGG and pSARS-CoV-2 PLpro using TranIT-LT1 (Mirus Bio) in the presence of serial diluted S-217622 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2 µL of TransIT mRNA reagent (Mirus Bio). Transfection reactions were incubated at room temperature for 3 minutes prior to drop-wise addition into each well ...
-
bioRxiv - Microbiology 2019Quote: ... 1 µg pSINrep21/YFV NS1 plasmid DNA was transfected into BHK-21 clone 15 cells by using 8 µl TransIT LT1 reagent (Mirus Bio, Wisconsin, MD) and low-serum OptiMem (Life Technologies) ...
-
bioRxiv - Molecular Biology 2022Quote: ... scDNAs were Cy5-labeled using the Label IT® Nucleic Acid Labeling Kit (Mirus Bio LLC, Madison, WI, USA; WI 53719), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... the samples were washed with 2 × SSC three times and then the nucleic acids in the samples were amine-modified using a Label IT Amine modifying kit (Mirus Bio) for 30 min at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were transferred into cuvettes (2 mm gap, Mirus, MIR50121) and subjected for electroporation using Nucleofector2b (Lonza) ...
-
Membrane integration and topology of RIFIN and STEVOR proteins of the Plasmodium falciparum parasitebioRxiv - Biochemistry 2019Quote: ... and 5 μl Trans-IT®LT-1 transfection reagent (Mirus, USA) for 20 min ...
-
bioRxiv - Systems Biology 2020Quote: ... followed by incubation with 10fold diluted Label IT Amine Modifying Reagent in 1× Labeling Buffer A from Label IT Nucleic Acid Modifying Reagent (Mirus Bio MIR 3900) at room temperature for 45 minutes ...
-
bioRxiv - Systems Biology 2021Quote: ... followed by incubation with tenfold diluted Label IT amine modifying reagent in 1× labelling buffer A from Label IT nucleic acid modifying reagent (Mirus Bio MIR 3900) at room temperature for 45 minutes ...
-
bioRxiv - Biophysics 2019Quote: ... constructs containing an amber stop codon (TAG) at amino acid position 1353 or 1397 (1353stop or 1397stop) using TransIT transfection reagent (Mirus Bio LLC; Madison, WI) in a ratio of 3 µL of TransIT per µg of total DNA ...
-
bioRxiv - Immunology 2022Quote: ... plasmid was fluorescently labeled with the Cy5 fluorophores using the Mirus Label IT® tracker intracellular nucleic acid localization kit (MIR 7021, Mirus Bio, Madison, USA) according to the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: ... The ctDNA was fluorescently labeled with either Cx-rhodamine or CY5 using the Label IT® Nucleic Acid Labeling kit (Mirus Bio LLC, WI).
-
bioRxiv - Molecular Biology 2023Quote: The Cas9-sgRNA and Cas12a-crRNA were labeled with CX-rhodamine (Label IT® Nucleic Acid Labeling Reagents Rhodamine Kit, Mirus Bio, Madison, WI) (75 ...
-
bioRxiv - Neuroscience 2021Quote: ... using 2 μL of TransIT-Insect transfection reagent (Mirus Bio Cat #6104). Medium was replaced with serum-containing medium 5 hours after transfection ...