Labshake search
Citations for Mirus Bio :
51 - 100 of 246 citations for 7 Oxabicyclo 4.1.0 heptane 2 carboxylicacid 6 ethyl 1 methyl 5 oxo ethylester 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... or 2 µg of pPol1II-HA and 2 µg of pPol1II-NA) using TransIT-293 (Mirus). Virus supernatant was harvested 72 hours post-transfection and filtered through 0.22 µm filters ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL of Boost reagent (Mirus Bio) and 2 µL of TransIT mRNA reagent (Mirus Bio) ...
-
bioRxiv - Immunology 2022Quote: ... Primers were designed for the predicted coding region of Bma-LEC-1 and Bma-LEC-2 that incorporated restriction digest sites facilitating recombination into the pOETIC 6xHis Transfer Plasmid (Mirus Bio, Madison, WI) (Supplemental Materials 1) ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to the cells ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to cell monolayers ...
-
bioRxiv - Microbiology 2022Quote: ... 293T cells on 96-well plate were co-transfected with a set of pGS-AVLQS and pSARS-CoV-2 Mpro or a set of pGS-RLKGG and pSARS-CoV-2 PLpro using TranIT-LT1 (Mirus Bio) in the presence of serial diluted S-217622 ...
-
bioRxiv - Immunology 2021Quote: HEK 293T cells (106) were transfected in 6-well plates with corresponding plasmids with Transit LT1 transfection reagent (Mirus) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... HEK293 cells (150 cm2 dish) were transfected with 6 μg of each protein-coding plasmid by using TransIT (Mirus). Cell lysis and elution were performed as described above ...
-
bioRxiv - Cell Biology 2020Quote: ... 150 μL pre-warmed OPTI-MEM was placed in 1.5 mL tubes with 6 μL TransIT-LT1 transfection reagent (MIR 2300, Mirus), vortexed briefly ...
-
bioRxiv - Immunology 2019Quote: Viral particles were produced by transfection of HEK293FT cells in 6-well plates with 3µg DNA and 8µl TransIT-293 (Mirus Bio) per well ...
-
bioRxiv - Immunology 2022Quote: Viral particles were produced by transfection of HEK293FT cells in 6-well plates with 3μg DNA and 8μL TransIT-293 (Mirus Bio) per well ...
-
bioRxiv - Zoology 2022Quote: ... Four µg of either plasmid were transfected into 6 × 105 C6/36 cells using TransIT-2020 transfection reagent (Mirus) for 4 h ...
-
bioRxiv - Immunology 2023Quote: 293T cells were seeded in 6-well plates at 0.2M cells/ml and were transfected with TransIT-LT1 (Mirus) 24h later with 1500 ng of empty plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... followed by transfection 6 hours post seeding using different EBOV plasmids and TransIT-LT1 transfection reagent (Mirus Bio LLC) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were seeded into 14.5 cm dishes and transfected with 40 µg pTK-SM-N100-GFP-V5 expression vector using TransIT-2020 (Mirus Bio; 1 µg DNA: 2 µL reagent), delivered in Opti-MEM ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2 µL of TransIT mRNA reagent (Mirus Bio). Transfection reactions were incubated at room temperature for 3 minutes prior to drop-wise addition into each well ...
-
bioRxiv - Microbiology 2019Quote: ... HEK293 cells in 6 well plates were transfected with 500 ng/well of each protein-coding plasmid by using TransIT (Mirus). After 48 h ...
-
bioRxiv - Microbiology 2019Quote: ... MHV68 was produced by first making p0 virus by transfecting NIH 3T3 cells in 6-well plates with 2.5 μg BAC DNA using TransIT-X2 (Mirus Bio) for 24h ...
-
bioRxiv - Biochemistry 2020Quote: ... The following day they were transfected with 6 μg Gag plasmid + 6 μg vector plasmid + 3 μg pCMV-Rev (to support nuclear export of vector RNA) using Transit-293 (Mirus) following the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were transfected at a confluency of ∼80% with 600-1000 ng of plasmid and 6 uL of TransIT293T (Mirus) transfection reagent ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were transferred into cuvettes (2 mm gap, Mirus, MIR50121) and subjected for electroporation using Nucleofector2b (Lonza) ...
-
bioRxiv - Cell Biology 2022Quote: Viral particles were produced by transfection of 293FT cells in 6-well plates with 3 μg of total DNA and 8 mL TransIT-293 Transfection Reagent (Mirus Bio) per well ...
-
bioRxiv - Immunology 2022Quote: ... and NP proteins (23) were transfected into 50% confluent HEK293T cells in 6-well plates with TransIT-LT1 transfection reagent (Mirus Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: Viral particles were produced by transfection of 293FT cells in 6-well plates with 3 μg DNA and 8 μl TransIT-293 Transfection Reagent (Mirus Bio) per well ...
-
bioRxiv - Microbiology 2022Quote: ... were seeded into 6-well plates and transfected the next day with 200 ng pcDNA4/TO-RNR-3×FLAG using TransIT-LT1 (Mirus #2304). A3B-EGFP or A3A-EGFP expression was induced 6 hours after transfection with 50 ng/mL doxycycline ...
-
bioRxiv - Cell Biology 2022Quote: ... carrying the sequence of the gene to be over expressed and resistance to puromycin into 0.8×106 HEK293 cells in a 60 mm culture dish with 6 µl of TrasnIT (Cat. Nº: Mirus Bio. 293) containing 3 ml of complete media ...
-
bioRxiv - Microbiology 2022Quote: ... and were transfected into early passage NIH-3T3 cells in 6 well plates using TransIT-X2® dynamic delivery transfection system (Mirus). Viruses from cell culture supernatants were passaged on M2-10B4 cells followed by virus purification and titration [3] ...
-
bioRxiv - Molecular Biology 2023Quote: HeLa cells inducibly expressing GFP and Flag-HA-tagged UNKWT were seeded in 6-well dishes and transfected 24 hours later at about 40% confluence using the TransIT-X2 Dynamic Delivery System (Mirus, MIR6003) with a pool of siRNAs targeting CNOT7 (Horizon ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were grown in 6-well plates or 10-cm dishes and allowed to reach ~70% confluency before transient transfection using TransIT-2020 (Mirus, catalog #: 5400), or siRNA treatment (50 nM ...
-
bioRxiv - Molecular Biology 2020Quote: ... MEF cells were grown in 6-well plates to 80% confluency before transfection with RP-sgRNA11204G (1.5ug/well) using TransIT®-mRNA Transfection Kit (Mirus Bio LLC). After 24h post transfection ...
-
bioRxiv - Microbiology 2020Quote: ... Monolayers of BHK-T7 cells at ~50% confluency in 6-well plates were co-transfected using TransIT-LT1 transfection reagent (Mirus Bio LLC) with 0.8 μg of each of ten plasmid constructs representing the T1L or T3DI reovirus genome ...
-
bioRxiv - Microbiology 2022Quote: 3×105cells were seeded in 6-well plates and transfected with 3CLpro plasmids via TransIT-PRO (Mirus Bio LLC, Madison, WI, USA) and incubated overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 x 105 293T cells per well were seeded in 6-well plates and transfected one day later with GFP-Mpro-L plasmids using TransIT-pro (Mirus Bio LLC). After 10 hours ...
-
bioRxiv - Microbiology 2023Quote: 3 x 105 cells were seeded per well in 6-well plates and transfected one day after seeding with 3CLpro plasmids using TransIT-PRO (Mirus Bio LLC) and incubated 8-9 hours for Mpro-On and 10 hours for Mpro-Off assays ...
-
bioRxiv - Microbiology 2022Quote: 3×105 cells were seeded in 6-well plates and transfected with 3CLpro plasmids via TransIT-PRO (Mirus Bio LLC, Madison, WI, USA) and incubated overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were seeded in 10-cm dishes or 6-well plates and allowed to reach ∼70% confluency before transient transfection using TransIT-2020 (Mirus, catalog #: MIR 5400) according to the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2021Quote: ... using 2 μL of TransIT-Insect transfection reagent (Mirus Bio Cat #6104). Medium was replaced with serum-containing medium 5 hours after transfection ...
-
bioRxiv - Biochemistry 2021Quote: ... were seeded in 6-well dishes and transfected with siRNA (50 nM) after 24 hours using the TransIT-X2 lipid reagent (Mirus Bio cat. no. MIR6000) or RNAiMAX™ ...
-
bioRxiv - Microbiology 2023Quote: ... were grown in 6-well plates and transfected the next day with 2.5 μg DNA with TransIT-LT1 (Mirus Bio catalog number MIR-2304) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... with ∼ 600ng DNA and 2 µL TransIT-LT1 transfection reagents (Mirus Bio Corporation) following the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... 2 µg of plasmid DNA was transfected per dish using Transit 293T (Mirus) following the manufacturer’s instructions and measured at least 48 h later.
-
bioRxiv - Cell Biology 2022Quote: ... Cells were grown in 6-well plates or 10 cm dishes and allowed to reach ∼70% confluency before transient transfection using TransIT-2020 (Mirus Bio, Madison, WI, catalog #: MIR 5400) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were co-transfected with receptor of interest and TRUPATH plasmids at 1:1:1:1 DNA ratio (receptor:Gα-RLuc8:Gβ:Gγ-GFP2) via TransIT-2020 (Mirus Cat# MIR5400). Each condition required 97 µL of room-temperature 1x Opti-MEM (Gibco Cat# 31985070) ...
-
bioRxiv - Microbiology 2021Quote: ... and RdRp-N462 or RdRp-D462 were transfected into 293T cells at a 1:1:1 ratio using TransIT LT-1 (Mirus, Madison, WI). To normalize transfection efficiency ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with 5 μg of pACT-GFP-actin using TransIT-Insect transfection reagent (Mirus Bio) and incubated for 2 d at 28°C in Grace’s media with 10% FBS and antibiotics (100 μg/ml penicillin/streptomycin and 0.25 μg/ml Amphotericin B) ...
-
bioRxiv - Biophysics 2022Quote: ... with 600 – 1000 ng DNA and 2 μL TransIT-LT1 transfection reagents (Mirus Bio Corporation) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and 5 μg of pSBbi or pSBtet containing gene of interest using TransIT-LT1 transfection reagent (Mirus Bio), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... 250 μl of OptiMEM media and supplemented with 2 μl TransIT-2020 Transfection Reagent (Mirus, MIR5400). The transfection mix was incubated 20 min at room temperature and then added to the cell culture for 24 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... On day 2 cells were transfected with lentiviral DNA following the Mirus-LT1 (Mirus MIR 2300) transfection protocol ...