Labshake search
Citations for Mirus Bio :
1 - 50 of 268 citations for 7 Methyl 1 5 dioxo 1 2 3 5 tetrahydro indolizine 6 carbonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Membrane integration and topology of RIFIN and STEVOR proteins of the Plasmodium falciparum parasitebioRxiv - Biochemistry 2019Quote: ... and 5 μl Trans-IT®LT-1 transfection reagent (Mirus, USA) for 20 min ...
-
bioRxiv - Cancer Biology 2022Quote: All lentiviruses were produced by co-transfection of HEK 293T/17 cells with plasmid DNA for the respective lentiviral vector and the packaging components psPAX2 and pMD2.G at a 5:3:2 mass ratio (vector:psPAX2:pMD2.G) using TransIT-LT1 (Mirus MIR 2300). Lentiviral supernatants were collected at 48 and 72 hours post-transfection ...
-
bioRxiv - Cancer Biology 2023Quote: All lentiviruses were produced by co-transfection of HEK 293T/17 cells with plasmid DNA for the respective lentiviral vector and the packaging components psPAX2 and pMD2.G at a 5:3:2 mass ratio (vector:psPAX2:pMD2.G) using TransIT-LT1 (Mirus MIR 2300). Lentiviral supernatants were collected at 48 and 72 hours post-transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg pre-miR-181a-1 were labeled with cy3 using Nucleic Acid Labeling Kit (Mirus) following the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... at a dye:basepair ratio 1:5 using the Mirus Label IT Nucleic Acid Labeling Kit (Mirus Bio).
-
bioRxiv - Cancer Biology 2021Quote: ... Lentiviral vectors were co-transfected with packaging vectors VSVG and gag/pol in a ratio of 3:1:2 into HEK293T cells using Trans-IT Transfection reagent (Mirus). Viral supernatants were collected at 48 and 72 hr post-transfection ...
-
bioRxiv - Microbiology 2021Quote: ... using 3:1 TransIT-LT1 Transfection Reagent (Mirus Bio). Twenty-four hours later ...
-
bioRxiv - Microbiology 2022Quote: ... The final CPER product was transfected into Vero E6-TMPRSS2 cells seeded into 6-well plates (~ 5 × 105 cells per well) by using the TransIT-X2 Dynamic Delivery System (Mirus Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... resuspended in v3.1 medium supplemented with 2 μM thiazovivin and 5 μg/ml polybrene (Mirus, MIR 6620), transduced with the hDel-v1 or hDel-v2 lentiviral sgRNA library at a target infection rate of 25% ...
-
bioRxiv - Genetics 2023Quote: ... resuspended in v3.1 medium supplemented with 2 μM thiazovivin and 5 μg/ml polybrene (Mirus, MIR 6620), transduced with the hDel-v3 lentiviral sgRNA library at a target infection rate of 10% ...
-
bioRxiv - Cell Biology 2022Quote: Plasmids for expression of kinesin-1 or any of the kinesin-6 family motors tagged with monomeric NeonGreen and an FRB domain were cotransfected into COS-7 cells with a plasmid for expression of PEX3-mRFP-FKBP or GMAP210p-mRFP-2xFKBP at a ratio of 5:1 with TransIT-LT1 transfection reagent (Mirus). Eighteen hours after transfection ...
-
bioRxiv - Microbiology 2023Quote: ... Medium was changed 24 h later to 10 ml of 5 % FBS/DMEM and changed again 48 h later to 10 ml of 5 % FBS/DMEM containing 1 µg/ml of puromycin (Mirus). Cells were incubated in selection medium for 72 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... and RSV-REV in the ratio of (3:1:1:1) into HEK293T cells using Trans-IT transfection reagent (Mirus). Virus-rich supernatant was collected at 72 hr post-transfection ...
-
bioRxiv - Microbiology 2022Quote: ... using 6:1 TransIT-LT1 Transfection Reagent (Mirus Bio, Madison, WI, USA). One and six days after transfection ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 µL LT-1 transfection reagent (#MIR2020, Mirus Bio LLC), and 1 µL brain lysate (1ug/uL stock determined by BCA (5000001 ...
-
bioRxiv - Immunology 2021Quote: ... transfected with 44 μg plasmid encoding SARS-CoV-2 Spike (pCG1-SARS-2-S, Wuhan Hu-1) using Transit LT-1 (Mirus). The next day ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 μL of TransIT-LT1 (Mirus), and the transfection was performed as per manufacturer’s directions ...
-
bioRxiv - Biophysics 2021Quote: ... δ and ε subunits in the ratio 2:1:1:1 (TransIT® 293 transfection reagent; Mirus Bio, Madison, WI). Electrophysiological experiments started ~48 hours post-transfection ...
-
bioRxiv - Microbiology 2020Quote: ... were transfected with 2·5 µg serine protease expression plasmid or empty vector using TransIT-X2 Dynamic Delivery System (Mirus). One day later ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Microbiology 2023Quote: ... at a ratio of 3:1 PEI:total DNA or TransIT-LT1 (Mirus) at a ratio of 3:1 TransIT:DNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bait and prey plasmids containing fused fragments were then individually transfected together with VSVG and gag/pol packaging vectors in a ratio of 3:1:1 into HEK293T cells using Trans-IT Transfection reagent (Mirus) to produce retroviruses ...
-
bioRxiv - Cancer Biology 2024Quote: ... with a 4:2:1:1 ratio of the target:pMDLg:pMD2.G:pRSV-REV plasmids using Transit 293T reagent (Mirus). After 48 hours ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to the cells ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to cell monolayers ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 ug plasmid DNA and 3 uL TransIT-LT1 transfection reagent (Mirus, Cat#2300) were diluted in 100 uL Opti-MEM Reduced-Serum Medium (Gibco ...
-
bioRxiv - Microbiology 2022Quote: ... or 2:2:1 (33) with TransIT®-LT1 transfection reagent (Mirus Bio LLC, Madison, WI, USA) and the plasmids ...
-
bioRxiv - Cell Biology 2022Quote: siRNA was delivered to differentiated adipocytes (6-7 days post-differentiation) using the TransIT-X2® dynamic delivery system (MIR 6004; Mirus Bio). Opti-MEM I (31985062 ...
-
bioRxiv - Biophysics 2020Quote: 1μg of recombinant Plexin-B1 FL WT pCDNA 3.1 plasmid or Plexin-B1 FL mutants pCDNA 3.1 (as described above) was transfected to 80% confluent COS 7 cells on coverslips using 3 μL Trans IT 2020 transfection reagent (Mirus Bio) for 48 hours at 37 °C ...
-
bioRxiv - Genomics 2019Quote: ... were used to transfect 1 × 106 Huh-7 cells using the TransIT® mRNA transfection kit according to the manufacturer’s instructions (Mirus Bio LLC). At 72 h post transfection (p.t.) ...
-
bioRxiv - Biochemistry 2021Quote: ... and 1 μg of PiggyBac transposase expression vector (total = 3 μg) using TransIT-LT1 (Mirus Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... and a Venus-tagged N-terminal β-arrestin2 using 3:1 ratio of TransiT-2020 (Mirus). 5-HT2A receptor mutants were designed and performed using Q5 mutagenesis kit (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3:1 volume:mass ratio of Mirus TransIT®-LT1 transfection reagent (Mirus Bio LLC, Madison WI) to DNA ...
-
bioRxiv - Biophysics 2020Quote: Plasmids for expression of WT or mutant rat KIF1A(339)-LZ motors tagged with monomeric NeonGreen and an FRB domain were cotransfected into COS-7 cells with a plasmid for expression of PEX3-mRFP-FKBP at a ratio of 6:1 with TransITLT1 transfection reagent (Mirus). Eight hours after transfection ...
-
bioRxiv - Biochemistry 2020Quote: ... The following day they were transfected with 6 μg Gag plasmid + 6 μg vector plasmid + 3 μg pCMV-Rev (to support nuclear export of vector RNA) using Transit-293 (Mirus) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.2 μg pVSVG per 1 reaction in a 6-well plate well) into HEK 293T cells with TransIT-LT1 transfection reagent (Mirus #2304) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: Viral particles were produced by transfection of 293FT cells in 6-well plates with 3 μg of total DNA and 8 mL TransIT-293 Transfection Reagent (Mirus Bio) per well ...
-
bioRxiv - Microbiology 2020Quote: Viral particles were produced by transfection of 293FT cells in 6-well plates with 3 μg DNA and 8 μl TransIT-293 Transfection Reagent (Mirus Bio) per well ...
-
bioRxiv - Microbiology 2022Quote: ... were seeded into 6-well plates and transfected the next day with 200 ng pcDNA4/TO-RNR-3×FLAG using TransIT-LT1 (Mirus #2304). A3B-EGFP or A3A-EGFP expression was induced 6 hours after transfection with 50 ng/mL doxycycline ...
-
bioRxiv - Biochemistry 2021Quote: ... and 1 μg of PiggyBac transposase expression vector (total = 3 μg) using TransIT-LT1 (Mirus Bio, Madison, WI, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: 3×105cells were seeded in 6-well plates and transfected with 3CLpro plasmids via TransIT-PRO (Mirus Bio LLC, Madison, WI, USA) and incubated overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were plated in 6-well dishes and transfected with mEGFP-tagged DNAJC17 or deletion mutants using TransIt-LT1 reagent at a 3:1 ratio (Mirus). Cells were then trypsinized and replated on 4-well chambered coverglass (LabTek ...
-
bioRxiv - Cancer Biology 2019Quote: ... and VSV-G vectors at a 4:2:1 ratio with Mirus TransIT LT1 (Mirus Bio, LLC). Virus-containing supernatant was collected 48 and 72h after transfection and filtered through 0.45mm filters before concentration by ultracentrifugation (25,000 RPM for 2 hours with low decel) ...
-
bioRxiv - Microbiology 2022Quote: 3×105 cells were seeded in 6-well plates and transfected with 3CLpro plasmids via TransIT-PRO (Mirus Bio LLC, Madison, WI, USA) and incubated overnight ...
-
bioRxiv - Cancer Biology 2020Quote: ... were transfected at a 4:3:1 ratio using TransIT293 reagent into T225 flasks as indicated by the manufacturer (Mirus Bio). For individual sgRNA preparations ...
-
bioRxiv - Biochemistry 2022Quote: ... Lentivirus transfer vectors were packaged by co-transfection with psPAX2 and pMD2.G (4:3:1) using TransIT-2020 (Mirus Bio) in HEK293T cells ...
-
bioRxiv - Cell Biology 2023Quote: ... was then transfected into SH-SY5Y cells (50-60% confluent) in a 6-well plate using TransIT LT-1 reagent (Mirus Bio, Cat# MIR-2300). After 48 hr ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were co-transfected with receptor of interest and TRUPATH plasmids at 1:1:1:1 DNA ratio (receptor:Gα-RLuc8:Gβ:Gγ-GFP2) via TransIT-2020 (Mirus Cat# MIR5400). Each condition required 97 µL of room-temperature 1x Opti-MEM (Gibco Cat# 31985070) ...
-
bioRxiv - Microbiology 2020Quote: ... the cells were transfected with 1 μg of in vitro-transcribed J6/JFH-1 Rluc RNA or H77S.3/GLuc RNA using the TransIT mRNA transfection kit (Mirus Bio LLC) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2022Quote: Transfection of human pancreatic MIA PaCa-2 and BxPC-3 cells was performed with TransIT-mRNA (Mirus Bio) according to the manufacturer’s instructions ...