Labshake search
Citations for Mirus Bio :
101 - 150 of 269 citations for 7 3 2 3 5 dihydroxyphenyl 2 hydroxyethyl amino propyl 3 7 dihydro 1 3 dimethyl 1H purine 2 6 dione monohydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Iso-2 and Cdk1 and its mutant plasmids were transfected into the cells using TransIT-X2 transfection reagent (Mirus, cat# MIR6000). siRNA oligonucleotides specific for Rad 51 were purchased from Sigma (ESIRNA HUMAN RAD51 EHU045521) ...
-
bioRxiv - Genomics 2022Quote: ... in HK-2 human proximal tubule cells at approximately 70% confluency in 96-well plates by using TransIT-2020 Reagent (Mirus, #5404), following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were transfected with 250 ng of a pCDNA3.1(+) vector encoding for the SARS-CoV-2 spike protein using the TransIT®-LT1 Transfection Reagent (Mirus Bio). Six hours post transfection (p.t.) ...
-
bioRxiv - Microbiology 2023Quote: ... 2 x 105 cells were seeded in 12-well plates and transiently transfected with 2 μg of a plasmid encoding HCoV-OC43 N or eGFP with TransIT-LT1 Transfection Reagent (Mirus Bio). At indicated time post transfection ...
-
bioRxiv - Microbiology 2024Quote: ... 80% confluent monolayers of Vero E6 cells in 12-well plates were transfected with 1.0 μg per well of infectious SARS-CoV-2 BAC DNA or its mutated derivatives using TransIT®-LT1 transfection reagent according to manufacturer’s instructions (Mirus Bio). At 48 h post transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... Two samples each were treated with Opti-MEM with 2 µg of transfection DNA (either pJG01, or negative control without DNA) along with TransIT-X2 transfection reagent (Mirus Bio) premixed and allowed to incubate 5 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were passaged to 12-well tissue culture plates at a density of 1.5×105 cells/well (3.9×104 cells/cm2) and transfected with 500 ng plasmid DNA using 2 uL of TransIT-X2 transfection reagent (Mirus Bio, #MIR6005) and 100 uL Opti-MEM I reduced serum medium (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were transfected with a SARS-CoV-2 orf-expressing plasmid and the packaging plasmids using TransIT-LT1 transfection reagent (Mirus Bio, Madison, WI) according to the provider’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Transient transfection of FLAG-NMNAT1 and FLAG-NMNAT2 constructs (see Supplemental Table 2) was performed at ∼60% confluence using TransIT®-LT1 transfection reagent (Mirus Bio, Madison, WI) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... using 6:1 TransIT-LT1 Transfection Reagent (Mirus Bio, Madison, WI, USA). One and six days after transfection ...
-
bioRxiv - Microbiology 2022Quote: ... The final CPER product was transfected into Vero E6-TMPRSS2 cells seeded into 6-well plates (~ 5 × 105 cells per well) by using the TransIT-X2 Dynamic Delivery System (Mirus Bio) as per the manufacturer’s instructions ...
-
Membrane integration and topology of RIFIN and STEVOR proteins of the Plasmodium falciparum parasitebioRxiv - Biochemistry 2019Quote: ... and 5 μl Trans-IT®LT-1 transfection reagent (Mirus, USA) for 20 min ...
-
bioRxiv - Biophysics 2020Quote: Plasmids for expression of WT or mutant rat KIF1A(339)-LZ motors tagged with monomeric NeonGreen and an FRB domain were cotransfected into COS-7 cells with a plasmid for expression of PEX3-mRFP-FKBP at a ratio of 6:1 with TransITLT1 transfection reagent (Mirus). Eight hours after transfection ...
-
bioRxiv - Microbiology 2023Quote: ... and 6 μl TransIT-LT1 (Mirus, Madison, WI) in 200 μl serum-free Opti-MEM (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... and 6 µl of Transit-LT1 (Mirus #MIR2300). Two days after transfection lentivirus was harvested and mixed with equal parts fresh media before overlaying on top of target cell lines ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.2 μg pVSVG per 1 reaction in a 6-well plate well) into HEK 293T cells with TransIT-LT1 transfection reagent (Mirus #2304) following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... allowed to grow overnight and then transfected with either ShhN or mSMO plasmid DNA (6 µg DNA per 6 cm dish) using TransIT transfection reagent (Mirus Bio LLC) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg pre-miR-181a-1 were labeled with cy3 using Nucleic Acid Labeling Kit (Mirus) following the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... at a dye:basepair ratio 1:5 using the Mirus Label IT Nucleic Acid Labeling Kit (Mirus Bio).
-
bioRxiv - Cell Biology 2023Quote: ... was then transfected into SH-SY5Y cells (50-60% confluent) in a 6-well plate using TransIT LT-1 reagent (Mirus Bio, Cat# MIR-2300). After 48 hr ...
-
bioRxiv - Molecular Biology 2023Quote: ... before adding 6 µl of TransIT VirusGen transfection reagent (Mirus MIR6700). The transfection mixture was incubated for 10 to 15 min and then added dropwise to HEK293T cells ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were transfected with either Fugene 6 or with TransIT-LT1 (Mirus). For knockdown experiments ...
-
bioRxiv - Molecular Biology 2022Quote: ... 6×105 cells were resuspended in 100 μL Ingenio Electroporation Solution (Mirus), and RNP complex with either 100 pmol ssODN or 7.5 μg plasmid donor DNA was added to the cell suspension ...
-
bioRxiv - Cancer Biology 2022Quote: ... in 6-well plates by using TransIT-293 transfection reagent (Mirus #MIR2705) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Plasmids for expression of kinesin-1 or any of the kinesin-6 family motors tagged with monomeric NeonGreen and an FRB domain were cotransfected into COS-7 cells with a plasmid for expression of PEX3-mRFP-FKBP or GMAP210p-mRFP-2xFKBP at a ratio of 5:1 with TransIT-LT1 transfection reagent (Mirus). Eighteen hours after transfection ...
-
bioRxiv - Microbiology 2023Quote: ... Medium was changed 24 h later to 10 ml of 5 % FBS/DMEM and changed again 48 h later to 10 ml of 5 % FBS/DMEM containing 1 µg/ml of puromycin (Mirus). Cells were incubated in selection medium for 72 h ...
-
bioRxiv - Microbiology 2023Quote: ... and 6 μl of TransIT-X2 Dynamic Delivery System (Mirus Bio; #MIR 6000). Following incubation at room temperature for 25 min ...
-
bioRxiv - Biophysics 2019Quote: ... constructs containing an amber stop codon (TAG) at amino acid position 1353 or 1397 (1353stop or 1397stop) using TransIT transfection reagent (Mirus Bio LLC; Madison, WI) in a ratio of 3 µL of TransIT per µg of total DNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 μL of TransIT-LT1 (Mirus), and the transfection was performed as per manufacturer’s directions ...
-
bioRxiv - Genomics 2020Quote: ... HEK293T cells (4 × 105 cells/ 6-well dish) were transfected using LT1 reagent (Mirus Bio) with HDV-EGFP (1 ug) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... n=8 wells) complexed with 6 μL TransIT-2020 transfection reagent (Mirus Bio; MIR 5404) at a final DNA concentration of 8 ng/uL in Advanced DMEM (Thermo Fisher ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to the cells ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to cell monolayers ...
-
bioRxiv - Immunology 2021Quote: HEK 293T cells (106) were transfected in 6-well plates with corresponding plasmids with Transit LT1 transfection reagent (Mirus) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... HEK293 cells (150 cm2 dish) were transfected with 6 μg of each protein-coding plasmid by using TransIT (Mirus). Cell lysis and elution were performed as described above ...
-
bioRxiv - Cell Biology 2020Quote: ... 150 μL pre-warmed OPTI-MEM was placed in 1.5 mL tubes with 6 μL TransIT-LT1 transfection reagent (MIR 2300, Mirus), vortexed briefly ...
-
bioRxiv - Immunology 2019Quote: Viral particles were produced by transfection of HEK293FT cells in 6-well plates with 3µg DNA and 8µl TransIT-293 (Mirus Bio) per well ...
-
bioRxiv - Immunology 2022Quote: Viral particles were produced by transfection of HEK293FT cells in 6-well plates with 3μg DNA and 8μL TransIT-293 (Mirus Bio) per well ...
-
bioRxiv - Zoology 2022Quote: ... Four µg of either plasmid were transfected into 6 × 105 C6/36 cells using TransIT-2020 transfection reagent (Mirus) for 4 h ...
-
bioRxiv - Immunology 2023Quote: 293T cells were seeded in 6-well plates at 0.2M cells/ml and were transfected with TransIT-LT1 (Mirus) 24h later with 1500 ng of empty plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... followed by transfection 6 hours post seeding using different EBOV plasmids and TransIT-LT1 transfection reagent (Mirus Bio LLC) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... HEK293 cells in 6 well plates were transfected with 500 ng/well of each protein-coding plasmid by using TransIT (Mirus). After 48 h ...
-
bioRxiv - Microbiology 2019Quote: ... MHV68 was produced by first making p0 virus by transfecting NIH 3T3 cells in 6-well plates with 2.5 μg BAC DNA using TransIT-X2 (Mirus Bio) for 24h ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were transfected at a confluency of ∼80% with 600-1000 ng of plasmid and 6 uL of TransIT293T (Mirus) transfection reagent ...
-
bioRxiv - Immunology 2022Quote: ... and NP proteins (23) were transfected into 50% confluent HEK293T cells in 6-well plates with TransIT-LT1 transfection reagent (Mirus Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... carrying the sequence of the gene to be over expressed and resistance to puromycin into 0.8×106 HEK293 cells in a 60 mm culture dish with 6 µl of TrasnIT (Cat. Nº: Mirus Bio. 293) containing 3 ml of complete media ...
-
bioRxiv - Microbiology 2022Quote: ... and were transfected into early passage NIH-3T3 cells in 6 well plates using TransIT-X2® dynamic delivery transfection system (Mirus). Viruses from cell culture supernatants were passaged on M2-10B4 cells followed by virus purification and titration [3] ...
-
bioRxiv - Molecular Biology 2023Quote: HeLa cells inducibly expressing GFP and Flag-HA-tagged UNKWT were seeded in 6-well dishes and transfected 24 hours later at about 40% confluence using the TransIT-X2 Dynamic Delivery System (Mirus, MIR6003) with a pool of siRNAs targeting CNOT7 (Horizon ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were grown in 6-well plates or 10-cm dishes and allowed to reach ~70% confluency before transient transfection using TransIT-2020 (Mirus, catalog #: 5400), or siRNA treatment (50 nM ...