Labshake search
Citations for Mirus Bio :
151 - 200 of 277 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tacatgtatacagatttagccacgatatatgaacgcgctgggcgagtggaagggagaaacggctcgattactcaaatccctattctGacAatgcctaatA atggtaagttttggtatttggattataacacacctaatcattttaaagagagagaagacccatctaccttttcgagttgaagttattttgagaacacatc using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Cell Biology 2024Quote: ... the packaging plasmids psPAX2 (UK1701) and pMD2.G (UK1700) at 10:7.5:5 ratio using TransIT-293 Transfection Reagent (MIR2704, Mirus) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Szczesny) and 0.8 μg EGFP-CHIP plasmid using Mirus reagents: 2 ul TransIT-293 (MIR 2700, Mirus) for transfection of HEK293 Flp-In T-REx cells and 2 ul Trans-IT-HeLa and 1.3 ul Monster (MIR 2900 ...
-
bioRxiv - Immunology 2022Quote: H1 control AC16 cardiomyocytes and cGAS KO AC16s were seeded in 12-well plates and transfected with 5 mg of CT-DNA using Transit X2 (Mirus) at a 2:1 ratio for 8 h prior to harvest ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cells were transfected with 10 ug of the TRE library ± 5 ug of pcDNA3.1 containing a GPCR expression cassette using TransIT-2020 (Mirus Bio) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... transfected at confluence (Day -2) using Mirus TransIT-X2 transfection reagent (3ul per well; Mirus Bio LLC, US) and 250 ng plasmid DNA (either empty vector or FABP4 sgRNA) ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were transfected with 2 μg of DNA 24 - 48 hours before measurement using TransIT transfection reagents (Mirus). DRG neurons from adult (postnatal weeks 8–12 ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 µg of each sgRNA plasmid and 3 µg of dCas9-KRAB-MeCP2 plasmid were co-nucleofected into 1 × 106 mHypoA cells resuspended in a 1:1 mixture of Ingenio Electroporation reagent (Mirus Bio 50111) and OptiMEM (Gibco 31985062) ...
-
bioRxiv - Microbiology 2024Quote: ... pVSV-G and either pLRGatewayIRESeFYP-Vpr/Vpx or pLRGatewayIRESmApple-Vpr/Vpx at a ratio 1:1:1 with TransIT-lenti (Mirus, MIR 6603). To generate HIV vectors to make stable cell lines ...
-
Prom1 and Notch regulate ciliary length and dynamics in multiciliated cells of the airway epitheliumbioRxiv - Cell Biology 2022Quote: ... The VSV-G pseudotyped lentivirus was packaged by 5 plasmid co-transfection of HEK293T cells using TansIT Transfection Reagent (Mirus Bio) in 15 cm culture dishes (The protocol describing production of lentiviral particles can be found at http://www.www.bu.edu/dbin/stemcells/protocols) ...
-
bioRxiv - Microbiology 2020Quote: ... were seeded in 10-cm dishes at a density of 1e5 cells/cm2 and the following day transfected with 5 μg of spike expression plasmid with TransIT-Lenti (Mirus, 6600) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... were seeded in 10-cm dishes at a density of 1e5 cells/cm2 and the following day transfected with 5 μg of spike expression plasmid with TransIT-Lenti (Mirus, 6600) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... for transfection of HEK293 Flp-In T-REx cells and 2 ul Trans-IT-HeLa and 1.3 ul Monster (MIR 2900, Mirus) for HeLa Flp-In T-REx cells ...
-
bioRxiv - Microbiology 2020Quote: BHK-21 cells were seeded in 48-well plates at 5×104/well in DMEM-10% one day prior to transfection with 500ng of different species ACE2-expression constructs or empty vector (pDISPLAY) (Sup.Table.2) in OptiMEM and TransIT-X2 (Mirus) transfection reagent according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... cells were transfected with a plasmid encoding for SARS-CoV-2 S-glycoprotein (YP_009724390.1) harboring a C-terminal 19 aa truncation using TransIT-Lenti (Mirus Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Caco-2 cells were plated (10·106 cells) in 500μl of the Ingenio electroporation solution (Mirus Vio, Wisconsin, USA). The transfected cells were selected using the antibiotic geneticin/G418 (Gibco-Thermo Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 1 μl TransIT (Mirus Bio TransIT-mRNA transfection kit ...
-
bioRxiv - Microbiology 2020Quote: ... or Transit LT-1 (Mirus) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... or Transit LT-1 (Mirus).
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells were transfected with 25 nM scramble or PLIN 5 siRNA (Dharmacon, Lafayette, CO, USA) using TransIT-TKO (Mirus Bio LLC) according to manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... 1 µl of mRNA Boost Reagent and 1 µl of TransIT-mRNA Reagent (Mirus Bio) and incubated for 5 min at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... and psPAX2 at a ratio of 1:1:0.1 using TransIT-LT1 transfection reagent (Mirus). The resulting blend was then filtered through a cellulose acetate membrane (0.45 µm ...
-
bioRxiv - Neuroscience 2021Quote: TDP-43 inducible knockdown SH-SY5Y cells were electroporated with 2 μg of DNA with the Ingenio electroporation kit (Mirus) using the A-023 setting on an Amaxa II nucleofector (Lonza) ...
-
bioRxiv - Immunology 2020Quote: HEK293T cells were transiently transfected with mRNA encoding SARS-CoV-2 WT S or S-2P protein using a TranIT mRNA transfection kit (Mirus). After 24 hr ...
-
bioRxiv - Immunology 2019Quote: ... and pZIP-mCMV-ZsGreen-shRNA NT Control or mTOR plasmids (2 µg; Transomic) using the TransIT-LT1 transfection reagent (Mirus) as per manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... purified using a Nucleospin kit (Machery-Nagel) and transfected into 2 mL of 293F cells (0.5 mL/mL) using TransIT-Lenti (Mirus bio). The virus was amplified ...
-
bioRxiv - Genomics 2023Quote: ... 4ug of packing plasmids psPAX.2 and 2ug of the envelope vector pMD2.G diluted in OptiMEM medium and Trans-Ltl transfection reagent (Mirus). For the generation of gRNA lentivirus ...
-
bioRxiv - Neuroscience 2023Quote: ... and pHR: mU6-sgRNA-EF1A-puro-P2A-BFP (sgRNA-BFP) (1:1:1) using 24 μL TransIT®-LT1 Transfection Reagent (Mirus Bio, Cat. No. MIR 2300) in a final volume of 1000uL Opti-MEM medium (ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... SK-MEL-2 cells were seeded on 18 mm coverslips at a density of 2 × 105 cells and transfected using TransIT-X2 (Mirus Bio) according to manufactures’ instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Iso-2 and Cdk1 and its mutant plasmids were transfected into the cells using TransIT-X2 transfection reagent (Mirus, cat# MIR6000). siRNA oligonucleotides specific for Rad 51 were purchased from Sigma (ESIRNA HUMAN RAD51 EHU045521) ...
-
bioRxiv - Genomics 2022Quote: ... in HK-2 human proximal tubule cells at approximately 70% confluency in 96-well plates by using TransIT-2020 Reagent (Mirus, #5404), following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were transfected with 250 ng of a pCDNA3.1(+) vector encoding for the SARS-CoV-2 spike protein using the TransIT®-LT1 Transfection Reagent (Mirus Bio). Six hours post transfection (p.t.) ...
-
bioRxiv - Microbiology 2023Quote: ... 2 x 105 cells were seeded in 12-well plates and transiently transfected with 2 μg of a plasmid encoding HCoV-OC43 N or eGFP with TransIT-LT1 Transfection Reagent (Mirus Bio). At indicated time post transfection ...
-
bioRxiv - Microbiology 2024Quote: ... 80% confluent monolayers of Vero E6 cells in 12-well plates were transfected with 1.0 μg per well of infectious SARS-CoV-2 BAC DNA or its mutated derivatives using TransIT®-LT1 transfection reagent according to manufacturer’s instructions (Mirus Bio). At 48 h post transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... Two samples each were treated with Opti-MEM with 2 µg of transfection DNA (either pJG01, or negative control without DNA) along with TransIT-X2 transfection reagent (Mirus Bio) premixed and allowed to incubate 5 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were passaged to 12-well tissue culture plates at a density of 1.5×105 cells/well (3.9×104 cells/cm2) and transfected with 500 ng plasmid DNA using 2 uL of TransIT-X2 transfection reagent (Mirus Bio, #MIR6005) and 100 uL Opti-MEM I reduced serum medium (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... H1 plasmid library with the top 5 sgRNA per gene21 were transfected into HEK293s using the TransIT®-Lenti Transfection Reagent (Mirus, Cat. No. MIR 6606) along with third generation lentiviral packaging mix ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were transfected with a SARS-CoV-2 orf-expressing plasmid and the packaging plasmids using TransIT-LT1 transfection reagent (Mirus Bio, Madison, WI) according to the provider’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... For the complementation assay 100ng of total DNA (1:1 ratio of plasmids) was transfected into 293T cells in 96-well plates using TansIT(R)-LT1 (Mirus) transfection reagent according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfection was performed using TransIT-LT-1 (Mirus) transfection reagent and 2500ng plasmid/flask ...
-
bioRxiv - Molecular Biology 2021Quote: ... Transient transfection of FLAG-NMNAT1 and FLAG-NMNAT2 constructs (see Supplemental Table 2) was performed at ∼60% confluence using TransIT®-LT1 transfection reagent (Mirus Bio, Madison, WI) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and pMDLg/pRRE) at a 1:1 ratio and transfected into HEK293T cells using TransIT LT1 transfection reagent (Mirus Bio LLC). After 72 h virus-containing supernatants were collected ...
-
bioRxiv - Cell Biology 2023Quote: Differentiated N2a cells were transfected with mRFP or syn-p2a-mRFP (1 μg) and mito GcaMP6f (1 μg) using TransIT-X2® Dynamic Delivery System (Mirus Bio) according to manufacturer’s instructions before reculturing in normal medium for 24 hours ...
-
bioRxiv - Genomics 2020Quote: ... Transit LT-1 reagent (cat. # MIR 2300) from Mirus Bio ...
-
bioRxiv - Microbiology 2022Quote: ... by Trans IT LT-1 (Mirus Bio, Madison, WI). Single cell clones were established by the limit dilution method ...
-
bioRxiv - Genomics 2023Quote: ... Transit LT-1 reagent (cat. # MIR 2300) from Mirus Bio ...
-
bioRxiv - Microbiology 2022Quote: ... indicated plasmids were transfected using LT-1 Reagent (Mirus) and cells were then fixed with 5% methanol-free formaldehyde or treated with IFN or TNF-alpha before fixation ...
-
bioRxiv - Molecular Biology 2019Quote: ... RRE and REV using TransIT LT-1 transfection reagent (Mirus). Viral transductions were performed in the presence of 4-8 µg/mL polybrene (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... pTM-P and 1 pTM-L using TransIT-LT1 (Mirus) and incubated at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: Transfections were performed using Trans-IT LT1 (TLT-1) (Mirus Bio) according to the manufacturer’s instruction.