Labshake search
Citations for Mirus Bio :
1 - 50 of 226 citations for 6H Imidazo 4 5 h quinolin 6 one 1 9 dihydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Medium was changed 24 h later to 10 ml of 5 % FBS/DMEM and changed again 48 h later to 10 ml of 5 % FBS/DMEM containing 1 µg/ml of puromycin (Mirus). Cells were incubated in selection medium for 72 h ...
-
bioRxiv - Biochemistry 2023Quote: ... transfected with 9 μg HA-tagged and 9 μg Flag-tagged constructs using TransIT-LT1 transfection reagents (Mirus). The transfected cells were cultured for another two days ...
-
bioRxiv - Genomics 2020Quote: ... HEK293T cells (4 × 105 cells/ 6-well dish) were transfected using LT1 reagent (Mirus Bio) with HDV-EGFP (1 ug) ...
-
bioRxiv - Microbiology 2019Quote: ... were plated at 2 × 105 cells/mL in 2 mL in 6-well plates one day prior to transfection using TransIT-LT1 reagent (Mirus Bio LLC) with 3 μL of transfection reagent per μg of DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 x 105 293T cells per well were seeded in 6-well plates and transfected one day later with GFP-Mpro-L plasmids using TransIT-pro (Mirus Bio LLC). After 10 hours ...
-
bioRxiv - Microbiology 2023Quote: 3 x 105 cells were seeded per well in 6-well plates and transfected one day after seeding with 3CLpro plasmids using TransIT-PRO (Mirus Bio LLC) and incubated 8-9 hours for Mpro-On and 10 hours for Mpro-Off assays ...
-
bioRxiv - Microbiology 2022Quote: ... using 6:1 TransIT-LT1 Transfection Reagent (Mirus Bio, Madison, WI, USA). One and six days after transfection ...
-
bioRxiv - Biochemistry 2019Quote: ... in a 40:1 ratio for 48 h using TransIT 2020 (Mirus Bio) or Dharmafect Duo (Dharmacon) ...
-
bioRxiv - Genomics 2021Quote: ... and pMD2.G at a ratio of 9:8:1 by mass using TransIT-LT1 transfection reagent (Mirus MIR 2306) at a ratio of 3 μL transfection reagent per 1 μg plasmid ...
-
bioRxiv - Developmental Biology 2023Quote: ... The dCas9-KRAB-mCherry plasmid was mixed with the pCMV_ΔR8.91 and pMD2.G packaging vectors at a ratio of 9:8:1 with TransIT®-Lenti Transfection Reagent (Mirus) in optiMEM (Gibco ...
-
bioRxiv - Biochemistry 2023Quote: ... This mix was combined with 9 μL of TransIT-LT1 (Mirus) and 15 µL of OptiMEM ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... This mix was combined with 9 μL of TransIT-LT1 (Mirus) and 15 µL of OptiMEM ...
-
bioRxiv - Molecular Biology 2020Quote: ... to be integrated into the genomic FRT site was cloned into the pcDNA5/FRT/TO vector backbone and transfected together with pOG44 Flp-In recombinase in a 9:1 ratio using either Trans-IT 293 transfection reagent (Mirus, USA) or Lipofectamine 3000 (Thermo Fisher Scientific ...
-
BTBD9 is a novel component of IGF signaling and regulates manganese-induced dopaminergic dysfunctionbioRxiv - Neuroscience 2021Quote: ... pGFP-HPO-9 or pGFP-BTBD9a plasmid using TransIT®-LT1 (Mirus). The cells were incubated with transfection complex for 24 hours at incubator with the supplementation of 5% CO2 at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... The final CPER product was transfected into Vero E6-TMPRSS2 cells seeded into 6-well plates (~ 5 × 105 cells per well) by using the TransIT-X2 Dynamic Delivery System (Mirus Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... or UL148HA were transfected using 9 μL of TransIT-2020 reagent (Mirus, Inc, #MIR 5404) into 6 × 105 HEK-293T cells that had been seeded into wells of a six-well cluster plate ...
-
bioRxiv - Microbiology 2022Quote: Monolayers of HEK293T cells grown in 9 cm dishes were transfected with TransIT-LT1 (Mirus) using 7.7 μg of pEGFP-N1 (for GFP alone) ...
-
bioRxiv - Cancer Biology 2024Quote: ... with a 4:2:1:1 ratio of the target:pMDLg:pMD2.G:pRSV-REV plasmids using Transit 293T reagent (Mirus). After 48 hours ...
-
Membrane integration and topology of RIFIN and STEVOR proteins of the Plasmodium falciparum parasitebioRxiv - Biochemistry 2019Quote: ... and 5 μl Trans-IT®LT-1 transfection reagent (Mirus, USA) for 20 min ...
-
bioRxiv - Biophysics 2020Quote: Plasmids for expression of WT or mutant rat KIF1A(339)-LZ motors tagged with monomeric NeonGreen and an FRB domain were cotransfected into COS-7 cells with a plasmid for expression of PEX3-mRFP-FKBP at a ratio of 6:1 with TransITLT1 transfection reagent (Mirus). Eight hours after transfection ...
-
bioRxiv - Microbiology 2023Quote: ... and 6 μl TransIT-LT1 (Mirus, Madison, WI) in 200 μl serum-free Opti-MEM (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... and 6 µl of Transit-LT1 (Mirus #MIR2300). Two days after transfection lentivirus was harvested and mixed with equal parts fresh media before overlaying on top of target cell lines ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.2 μg pVSVG per 1 reaction in a 6-well plate well) into HEK 293T cells with TransIT-LT1 transfection reagent (Mirus #2304) following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... allowed to grow overnight and then transfected with either ShhN or mSMO plasmid DNA (6 µg DNA per 6 cm dish) using TransIT transfection reagent (Mirus Bio LLC) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Virus inoculum was removed after 1 h and cells were transfected with a mixture of plasmids using TransIT-LT1 (Mirus Bio # MIR 2300), including pVSV-eGFP-deltaG_SARS-CoV-2 Spike (5 µg) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and VSV-G vectors at a 4:2:1 ratio with Mirus TransIT LT1 (Mirus Bio, LLC). Virus-containing supernatant was collected 48 and 72h after transfection and filtered through 0.45mm filters before concentration by ultracentrifugation (25,000 RPM for 2 hours with low decel) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg pre-miR-181a-1 were labeled with cy3 using Nucleic Acid Labeling Kit (Mirus) following the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... at a dye:basepair ratio 1:5 using the Mirus Label IT Nucleic Acid Labeling Kit (Mirus Bio).
-
bioRxiv - Molecular Biology 2020Quote: ... were transfected for the last 24 h using TransIT-2020 (Mirus Bio). To generate siRNA-resistant expression vectors ...
-
bioRxiv - Cell Biology 2023Quote: ... was then transfected into SH-SY5Y cells (50-60% confluent) in a 6-well plate using TransIT LT-1 reagent (Mirus Bio, Cat# MIR-2300). After 48 hr ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were passaged to 12-well tissue culture plates at a density of 1.5×105 cells/well (3.9×104 cells/cm2) and transfected with 500 ng plasmid DNA using 2 uL of TransIT-X2 transfection reagent (Mirus Bio, #MIR6005) and 100 uL Opti-MEM I reduced serum medium (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... before adding 6 µl of TransIT VirusGen transfection reagent (Mirus MIR6700). The transfection mixture was incubated for 10 to 15 min and then added dropwise to HEK293T cells ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were transfected with either Fugene 6 or with TransIT-LT1 (Mirus). For knockdown experiments ...
-
bioRxiv - Molecular Biology 2022Quote: ... 6×105 cells were resuspended in 100 μL Ingenio Electroporation Solution (Mirus), and RNP complex with either 100 pmol ssODN or 7.5 μg plasmid donor DNA was added to the cell suspension ...
-
bioRxiv - Cancer Biology 2022Quote: ... in 6-well plates by using TransIT-293 transfection reagent (Mirus #MIR2705) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... were transfected at a 4:3:1 ratio using TransIT293 reagent into T225 flasks as indicated by the manufacturer (Mirus Bio). For individual sgRNA preparations ...
-
bioRxiv - Biochemistry 2022Quote: ... Lentivirus transfer vectors were packaged by co-transfection with psPAX2 and pMD2.G (4:3:1) using TransIT-2020 (Mirus Bio) in HEK293T cells ...
-
bioRxiv - Cell Biology 2022Quote: Plasmids for expression of kinesin-1 or any of the kinesin-6 family motors tagged with monomeric NeonGreen and an FRB domain were cotransfected into COS-7 cells with a plasmid for expression of PEX3-mRFP-FKBP or GMAP210p-mRFP-2xFKBP at a ratio of 5:1 with TransIT-LT1 transfection reagent (Mirus). Eighteen hours after transfection ...
-
bioRxiv - Microbiology 2023Quote: ... and 6 μl of TransIT-X2 Dynamic Delivery System (Mirus Bio; #MIR 6000). Following incubation at room temperature for 25 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 μL of TransIT-LT1 (Mirus), and the transfection was performed as per manufacturer’s directions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... n=8 wells) complexed with 6 μL TransIT-2020 transfection reagent (Mirus Bio; MIR 5404) at a final DNA concentration of 8 ng/uL in Advanced DMEM (Thermo Fisher ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Bioengineering 2023Quote: ... low passage cells were plated at a density of 25,000 cells per well in a 96-well plate and transfected at > 80% confluence with all-in-one PiggyBac plasmids containing CasRx using TransIT-X2 (MIR 6003, Mirus) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Transfection of the pIRO-D system (40) was performed 24 h post-seeding using TransIT-LT1 (Mirus Bio) transfection reagent according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: HEK293Ts were plated one day prior to transfection and were transfected with either calcium phosphate or TransIT-LT1 (Mirus, Madison, WI) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... Motor neuron progenitors were sparsely cultured on a 24-well plate and one day after passaging transfected using Mirus LT1 (Mirus Bio) transfection reagent ...
-
bioRxiv - Synthetic Biology 2023Quote: Cells were seeded in 96-well plates one day before transfection with TransIT-PRO transfection kit (Mirus Bio, Madison, WI, US) according to manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2024Quote: ... cells in one 35 mm dish were either transiently transfected with the construct to be imaged using TransIT-293 lipofection reagent (Mirus Bio) or were virally transduced with a lentivirus ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to the cells ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to cell monolayers ...