Labshake search
Citations for Mirus Bio :
1 - 50 of 75 citations for 6 CHLOROPURINE RIBOSIDE 5' O MONOPHOSPHATE SODIUM SALT since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The final CPER product was transfected into Vero E6-TMPRSS2 cells seeded into 6-well plates (~ 5 × 105 cells per well) by using the TransIT-X2 Dynamic Delivery System (Mirus Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and 6 μl TransIT-LT1 (Mirus, Madison, WI) in 200 μl serum-free Opti-MEM (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... and 6 µl of Transit-LT1 (Mirus #MIR2300). Two days after transfection lentivirus was harvested and mixed with equal parts fresh media before overlaying on top of target cell lines ...
-
bioRxiv - Cancer Biology 2019Quote: ... allowed to grow overnight and then transfected with either ShhN or mSMO plasmid DNA (6 µg DNA per 6 cm dish) using TransIT transfection reagent (Mirus Bio LLC) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... before adding 6 µl of TransIT VirusGen transfection reagent (Mirus MIR6700). The transfection mixture was incubated for 10 to 15 min and then added dropwise to HEK293T cells ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were transfected with either Fugene 6 or with TransIT-LT1 (Mirus). For knockdown experiments ...
-
bioRxiv - Microbiology 2022Quote: ... using 6:1 TransIT-LT1 Transfection Reagent (Mirus Bio, Madison, WI, USA). One and six days after transfection ...
-
bioRxiv - Molecular Biology 2022Quote: ... 6×105 cells were resuspended in 100 μL Ingenio Electroporation Solution (Mirus), and RNP complex with either 100 pmol ssODN or 7.5 μg plasmid donor DNA was added to the cell suspension ...
-
bioRxiv - Cancer Biology 2022Quote: ... in 6-well plates by using TransIT-293 transfection reagent (Mirus #MIR2705) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and 6 μl of TransIT-X2 Dynamic Delivery System (Mirus Bio; #MIR 6000). Following incubation at room temperature for 25 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 μL of TransIT-LT1 (Mirus), and the transfection was performed as per manufacturer’s directions ...
-
bioRxiv - Genomics 2020Quote: ... HEK293T cells (4 × 105 cells/ 6-well dish) were transfected using LT1 reagent (Mirus Bio) with HDV-EGFP (1 ug) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... n=8 wells) complexed with 6 μL TransIT-2020 transfection reagent (Mirus Bio; MIR 5404) at a final DNA concentration of 8 ng/uL in Advanced DMEM (Thermo Fisher ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to the cells ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to cell monolayers ...
-
bioRxiv - Immunology 2021Quote: HEK 293T cells (106) were transfected in 6-well plates with corresponding plasmids with Transit LT1 transfection reagent (Mirus) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... HEK293 cells (150 cm2 dish) were transfected with 6 μg of each protein-coding plasmid by using TransIT (Mirus). Cell lysis and elution were performed as described above ...
-
bioRxiv - Cell Biology 2020Quote: ... 150 μL pre-warmed OPTI-MEM was placed in 1.5 mL tubes with 6 μL TransIT-LT1 transfection reagent (MIR 2300, Mirus), vortexed briefly ...
-
bioRxiv - Immunology 2019Quote: Viral particles were produced by transfection of HEK293FT cells in 6-well plates with 3µg DNA and 8µl TransIT-293 (Mirus Bio) per well ...
-
bioRxiv - Immunology 2022Quote: Viral particles were produced by transfection of HEK293FT cells in 6-well plates with 3μg DNA and 8μL TransIT-293 (Mirus Bio) per well ...
-
bioRxiv - Zoology 2022Quote: ... Four µg of either plasmid were transfected into 6 × 105 C6/36 cells using TransIT-2020 transfection reagent (Mirus) for 4 h ...
-
bioRxiv - Immunology 2023Quote: 293T cells were seeded in 6-well plates at 0.2M cells/ml and were transfected with TransIT-LT1 (Mirus) 24h later with 1500 ng of empty plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... followed by transfection 6 hours post seeding using different EBOV plasmids and TransIT-LT1 transfection reagent (Mirus Bio LLC) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... HEK293 cells in 6 well plates were transfected with 500 ng/well of each protein-coding plasmid by using TransIT (Mirus). After 48 h ...
-
bioRxiv - Microbiology 2019Quote: ... MHV68 was produced by first making p0 virus by transfecting NIH 3T3 cells in 6-well plates with 2.5 μg BAC DNA using TransIT-X2 (Mirus Bio) for 24h ...
-
bioRxiv - Biochemistry 2020Quote: ... The following day they were transfected with 6 μg Gag plasmid + 6 μg vector plasmid + 3 μg pCMV-Rev (to support nuclear export of vector RNA) using Transit-293 (Mirus) following the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2020Quote: Plasmids for expression of WT or mutant rat KIF1A(339)-LZ motors tagged with monomeric NeonGreen and an FRB domain were cotransfected into COS-7 cells with a plasmid for expression of PEX3-mRFP-FKBP at a ratio of 6:1 with TransITLT1 transfection reagent (Mirus). Eight hours after transfection ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were transfected at a confluency of ∼80% with 600-1000 ng of plasmid and 6 uL of TransIT293T (Mirus) transfection reagent ...
-
bioRxiv - Cell Biology 2022Quote: Viral particles were produced by transfection of 293FT cells in 6-well plates with 3 μg of total DNA and 8 mL TransIT-293 Transfection Reagent (Mirus Bio) per well ...
-
bioRxiv - Immunology 2022Quote: ... and NP proteins (23) were transfected into 50% confluent HEK293T cells in 6-well plates with TransIT-LT1 transfection reagent (Mirus Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: Viral particles were produced by transfection of 293FT cells in 6-well plates with 3 μg DNA and 8 μl TransIT-293 Transfection Reagent (Mirus Bio) per well ...
-
bioRxiv - Microbiology 2022Quote: ... were seeded into 6-well plates and transfected the next day with 200 ng pcDNA4/TO-RNR-3×FLAG using TransIT-LT1 (Mirus #2304). A3B-EGFP or A3A-EGFP expression was induced 6 hours after transfection with 50 ng/mL doxycycline ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.2 μg pVSVG per 1 reaction in a 6-well plate well) into HEK 293T cells with TransIT-LT1 transfection reagent (Mirus #2304) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... carrying the sequence of the gene to be over expressed and resistance to puromycin into 0.8×106 HEK293 cells in a 60 mm culture dish with 6 µl of TrasnIT (Cat. Nº: Mirus Bio. 293) containing 3 ml of complete media ...
-
bioRxiv - Microbiology 2022Quote: ... and were transfected into early passage NIH-3T3 cells in 6 well plates using TransIT-X2® dynamic delivery transfection system (Mirus). Viruses from cell culture supernatants were passaged on M2-10B4 cells followed by virus purification and titration [3] ...
-
bioRxiv - Molecular Biology 2023Quote: HeLa cells inducibly expressing GFP and Flag-HA-tagged UNKWT were seeded in 6-well dishes and transfected 24 hours later at about 40% confluence using the TransIT-X2 Dynamic Delivery System (Mirus, MIR6003) with a pool of siRNAs targeting CNOT7 (Horizon ...
-
Membrane integration and topology of RIFIN and STEVOR proteins of the Plasmodium falciparum parasitebioRxiv - Biochemistry 2019Quote: ... and 5 μl Trans-IT®LT-1 transfection reagent (Mirus, USA) for 20 min ...
-
bioRxiv - Microbiology 2019Quote: ... were plated at 2 × 105 cells/mL in 2 mL in 6-well plates one day prior to transfection using TransIT-LT1 reagent (Mirus Bio LLC) with 3 μL of transfection reagent per μg of DNA ...
-
bioRxiv - Cell Biology 2022Quote: siRNA was delivered to differentiated adipocytes (6-7 days post-differentiation) using the TransIT-X2® dynamic delivery system (MIR 6004; Mirus Bio). Opti-MEM I (31985062 ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were grown in 6-well plates or 10-cm dishes and allowed to reach ~70% confluency before transient transfection using TransIT-2020 (Mirus, catalog #: 5400), or siRNA treatment (50 nM ...
-
bioRxiv - Molecular Biology 2020Quote: ... MEF cells were grown in 6-well plates to 80% confluency before transfection with RP-sgRNA11204G (1.5ug/well) using TransIT®-mRNA Transfection Kit (Mirus Bio LLC). After 24h post transfection ...
-
bioRxiv - Microbiology 2020Quote: ... Monolayers of BHK-T7 cells at ~50% confluency in 6-well plates were co-transfected using TransIT-LT1 transfection reagent (Mirus Bio LLC) with 0.8 μg of each of ten plasmid constructs representing the T1L or T3DI reovirus genome ...
-
bioRxiv - Microbiology 2022Quote: 293T cells were seeded at 2 × 105 cells/well in 6-well plates the day before transfection using TransIT-LT1 reagent (Mirus Bio LLC) at 3 μL transfection reagent/well as previously described 57 ...
-
bioRxiv - Microbiology 2022Quote: HEK293T were seeded at 2 × 105 cells/well in 6-well plates the day before transfection using TransIT-LT1 reagent (Mirus Bio LLC) at 5.8 μL transfection reagent/well ...
-
bioRxiv - Microbiology 2022Quote: 3×105cells were seeded in 6-well plates and transfected with 3CLpro plasmids via TransIT-PRO (Mirus Bio LLC, Madison, WI, USA) and incubated overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 x 105 293T cells per well were seeded in 6-well plates and transfected one day later with GFP-Mpro-L plasmids using TransIT-pro (Mirus Bio LLC). After 10 hours ...
-
bioRxiv - Microbiology 2023Quote: 3 x 105 cells were seeded per well in 6-well plates and transfected one day after seeding with 3CLpro plasmids using TransIT-PRO (Mirus Bio LLC) and incubated 8-9 hours for Mpro-On and 10 hours for Mpro-Off assays ...
-
bioRxiv - Microbiology 2022Quote: 3×105 cells were seeded in 6-well plates and transfected with 3CLpro plasmids via TransIT-PRO (Mirus Bio LLC, Madison, WI, USA) and incubated overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were seeded in 10-cm dishes or 6-well plates and allowed to reach ∼70% confluency before transient transfection using TransIT-2020 (Mirus, catalog #: MIR 5400) according to the manufacturer’s instruction ...