Labshake search
Citations for Mirus Bio :
1 - 50 of 244 citations for 6 4 METHOXY PHENYL 2 PHENYL PYRAZOLO 1 5 A PYRIMIDINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... with a 4:2:1:1 ratio of the target:pMDLg:pMD2.G:pRSV-REV plasmids using Transit 293T reagent (Mirus). After 48 hours ...
-
bioRxiv - Cancer Biology 2019Quote: ... and VSV-G vectors at a 4:2:1 ratio with Mirus TransIT LT1 (Mirus Bio, LLC). Virus-containing supernatant was collected 48 and 72h after transfection and filtered through 0.45mm filters before concentration by ultracentrifugation (25,000 RPM for 2 hours with low decel) ...
-
bioRxiv - Genomics 2020Quote: ... HEK293T cells (4 × 105 cells/ 6-well dish) were transfected using LT1 reagent (Mirus Bio) with HDV-EGFP (1 ug) ...
-
bioRxiv - Microbiology 2022Quote: ... using 6:1 TransIT-LT1 Transfection Reagent (Mirus Bio, Madison, WI, USA). One and six days after transfection ...
-
bioRxiv - Microbiology 2022Quote: ... The final CPER product was transfected into Vero E6-TMPRSS2 cells seeded into 6-well plates (~ 5 × 105 cells per well) by using the TransIT-X2 Dynamic Delivery System (Mirus Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... transfected with 44 μg plasmid encoding SARS-CoV-2 Spike (pCG1-SARS-2-S, Wuhan Hu-1) using Transit LT-1 (Mirus). The next day ...
-
bioRxiv - Microbiology 2019Quote: ... were plated at 2 × 105 cells/mL in 2 mL in 6-well plates one day prior to transfection using TransIT-LT1 reagent (Mirus Bio LLC) with 3 μL of transfection reagent per μg of DNA ...
-
bioRxiv - Microbiology 2022Quote: 293T cells were seeded at 2 × 105 cells/well in 6-well plates the day before transfection using TransIT-LT1 reagent (Mirus Bio LLC) at 3 μL transfection reagent/well as previously described 57 ...
-
bioRxiv - Microbiology 2022Quote: HEK293T were seeded at 2 × 105 cells/well in 6-well plates the day before transfection using TransIT-LT1 reagent (Mirus Bio LLC) at 5.8 μL transfection reagent/well ...
-
bioRxiv - Genetics 2023Quote: ... resuspended in v3.1 medium supplemented with 2 μM thiazovivin and 5 μg/ml polybrene (Mirus, MIR 6620), transduced with the hDel-v1 or hDel-v2 lentiviral sgRNA library at a target infection rate of 25% ...
-
bioRxiv - Genetics 2023Quote: ... resuspended in v3.1 medium supplemented with 2 μM thiazovivin and 5 μg/ml polybrene (Mirus, MIR 6620), transduced with the hDel-v3 lentiviral sgRNA library at a target infection rate of 10% ...
-
bioRxiv - Microbiology 2022Quote: ... or 2:2:1 (33) with TransIT®-LT1 transfection reagent (Mirus Bio LLC, Madison, WI, USA) and the plasmids ...
-
Membrane integration and topology of RIFIN and STEVOR proteins of the Plasmodium falciparum parasitebioRxiv - Biochemistry 2019Quote: ... and 5 μl Trans-IT®LT-1 transfection reagent (Mirus, USA) for 20 min ...
-
bioRxiv - Biophysics 2021Quote: ... δ and ε subunits in the ratio 2:1:1:1 (TransIT® 293 transfection reagent; Mirus Bio, Madison, WI). Electrophysiological experiments started ~48 hours post-transfection ...
-
bioRxiv - Microbiology 2020Quote: ... were transfected with 2·5 µg serine protease expression plasmid or empty vector using TransIT-X2 Dynamic Delivery System (Mirus). One day later ...
-
bioRxiv - Cancer Biology 2022Quote: All lentiviruses were produced by co-transfection of HEK 293T/17 cells with plasmid DNA for the respective lentiviral vector and the packaging components psPAX2 and pMD2.G at a 5:3:2 mass ratio (vector:psPAX2:pMD2.G) using TransIT-LT1 (Mirus MIR 2300). Lentiviral supernatants were collected at 48 and 72 hours post-transfection ...
-
bioRxiv - Cancer Biology 2023Quote: All lentiviruses were produced by co-transfection of HEK 293T/17 cells with plasmid DNA for the respective lentiviral vector and the packaging components psPAX2 and pMD2.G at a 5:3:2 mass ratio (vector:psPAX2:pMD2.G) using TransIT-LT1 (Mirus MIR 2300). Lentiviral supernatants were collected at 48 and 72 hours post-transfection ...
-
bioRxiv - Biophysics 2020Quote: Plasmids for expression of WT or mutant rat KIF1A(339)-LZ motors tagged with monomeric NeonGreen and an FRB domain were cotransfected into COS-7 cells with a plasmid for expression of PEX3-mRFP-FKBP at a ratio of 6:1 with TransITLT1 transfection reagent (Mirus). Eight hours after transfection ...
-
bioRxiv - Microbiology 2023Quote: ... and 6 μl TransIT-LT1 (Mirus, Madison, WI) in 200 μl serum-free Opti-MEM (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... and 6 µl of Transit-LT1 (Mirus #MIR2300). Two days after transfection lentivirus was harvested and mixed with equal parts fresh media before overlaying on top of target cell lines ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.2 μg pVSVG per 1 reaction in a 6-well plate well) into HEK 293T cells with TransIT-LT1 transfection reagent (Mirus #2304) following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... allowed to grow overnight and then transfected with either ShhN or mSMO plasmid DNA (6 µg DNA per 6 cm dish) using TransIT transfection reagent (Mirus Bio LLC) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg pre-miR-181a-1 were labeled with cy3 using Nucleic Acid Labeling Kit (Mirus) following the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... at a dye:basepair ratio 1:5 using the Mirus Label IT Nucleic Acid Labeling Kit (Mirus Bio).
-
bioRxiv - Cell Biology 2023Quote: ... was then transfected into SH-SY5Y cells (50-60% confluent) in a 6-well plate using TransIT LT-1 reagent (Mirus Bio, Cat# MIR-2300). After 48 hr ...
-
bioRxiv - Molecular Biology 2023Quote: ... before adding 6 µl of TransIT VirusGen transfection reagent (Mirus MIR6700). The transfection mixture was incubated for 10 to 15 min and then added dropwise to HEK293T cells ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were transfected with either Fugene 6 or with TransIT-LT1 (Mirus). For knockdown experiments ...
-
bioRxiv - Molecular Biology 2022Quote: ... 6×105 cells were resuspended in 100 μL Ingenio Electroporation Solution (Mirus), and RNP complex with either 100 pmol ssODN or 7.5 μg plasmid donor DNA was added to the cell suspension ...
-
bioRxiv - Cancer Biology 2022Quote: ... in 6-well plates by using TransIT-293 transfection reagent (Mirus #MIR2705) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... were transfected at a 4:3:1 ratio using TransIT293 reagent into T225 flasks as indicated by the manufacturer (Mirus Bio). For individual sgRNA preparations ...
-
bioRxiv - Biochemistry 2022Quote: ... Lentivirus transfer vectors were packaged by co-transfection with psPAX2 and pMD2.G (4:3:1) using TransIT-2020 (Mirus Bio) in HEK293T cells ...
-
bioRxiv - Cell Biology 2022Quote: Plasmids for expression of kinesin-1 or any of the kinesin-6 family motors tagged with monomeric NeonGreen and an FRB domain were cotransfected into COS-7 cells with a plasmid for expression of PEX3-mRFP-FKBP or GMAP210p-mRFP-2xFKBP at a ratio of 5:1 with TransIT-LT1 transfection reagent (Mirus). Eighteen hours after transfection ...
-
bioRxiv - Microbiology 2023Quote: ... Medium was changed 24 h later to 10 ml of 5 % FBS/DMEM and changed again 48 h later to 10 ml of 5 % FBS/DMEM containing 1 µg/ml of puromycin (Mirus). Cells were incubated in selection medium for 72 h ...
-
bioRxiv - Microbiology 2023Quote: ... and 6 μl of TransIT-X2 Dynamic Delivery System (Mirus Bio; #MIR 6000). Following incubation at room temperature for 25 min ...
-
bioRxiv - Neuroscience 2020Quote: ... and mRFP + Nuak 1 and 2 kinases was performed via chemical transfection using TransIT-X2 (Mirus Bio, Madison, WI) 48 hours following plating ...
-
bioRxiv - Cancer Biology 2023Quote: ... Control and BCAT1-KO U251 cells were reverse-transfected with 1µg/ml of TC3-R9P-3NLS pDNA using 1:2 of Trans-iT (Mirus). 48h after transfection ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lentiviral particles were produced by co-transfection of shRNA plasmids with psPAX and pMDG.2 in 293T cells using the Trans-IT LT-1 transfection reagent (Mirus). DM cells were infected by shRNA lentivirus twice via spinoculation in the presence of 5 μg/mL polybrene (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentiviral vectors were co-transfected with packaging vectors VSVG and gag/pol in a ratio of 3:1:2 into HEK293T cells using Trans-IT Transfection reagent (Mirus). Viral supernatants were collected at 48 and 72 hr post-transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 μL of TransIT-LT1 (Mirus), and the transfection was performed as per manufacturer’s directions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... n=8 wells) complexed with 6 μL TransIT-2020 transfection reagent (Mirus Bio; MIR 5404) at a final DNA concentration of 8 ng/uL in Advanced DMEM (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral vectors were produced in HEK-293T cells by co-transfection of the previously sequenced vector constructs with psPAX and pMDG.2 packaging plasmids using Trans-IT LT-1 (Mirus, MIR2700). HEK293T cells were incubated overnight at 37°C and the next day medium was changed for IMDM 10% HI-FBS ...
-
bioRxiv - Microbiology 2022Quote: ... or 2 µg of pPol1II-HA and 2 µg of pPol1II-NA) using TransIT-293 (Mirus). Virus supernatant was harvested 72 hours post-transfection and filtered through 0.22 µm filters ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL of Boost reagent (Mirus Bio) and 2 µL of TransIT mRNA reagent (Mirus Bio) ...
-
bioRxiv - Immunology 2022Quote: ... Primers were designed for the predicted coding region of Bma-LEC-1 and Bma-LEC-2 that incorporated restriction digest sites facilitating recombination into the pOETIC 6xHis Transfer Plasmid (Mirus Bio, Madison, WI) (Supplemental Materials 1) ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to the cells ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to cell monolayers ...
-
bioRxiv - Microbiology 2022Quote: ... 293T cells on 96-well plate were co-transfected with a set of pGS-AVLQS and pSARS-CoV-2 Mpro or a set of pGS-RLKGG and pSARS-CoV-2 PLpro using TranIT-LT1 (Mirus Bio) in the presence of serial diluted S-217622 ...
-
bioRxiv - Immunology 2021Quote: HEK 293T cells (106) were transfected in 6-well plates with corresponding plasmids with Transit LT1 transfection reagent (Mirus) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... HEK293 cells (150 cm2 dish) were transfected with 6 μg of each protein-coding plasmid by using TransIT (Mirus). Cell lysis and elution were performed as described above ...