Labshake search
Citations for Mirus Bio :
1 - 50 of 189 citations for 5 Isobutylcyclohexane 1 3 dione 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... using 3:1 TransIT-LT1 Transfection Reagent (Mirus Bio). Twenty-four hours later ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 µL LT-1 transfection reagent (#MIR2020, Mirus Bio LLC), and 1 µL brain lysate (1ug/uL stock determined by BCA (5000001 ...
-
bioRxiv - Microbiology 2023Quote: ... at a ratio of 3:1 PEI:total DNA or TransIT-LT1 (Mirus) at a ratio of 3:1 TransIT:DNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... and RSV-REV in the ratio of (3:1:1:1) into HEK293T cells using Trans-IT transfection reagent (Mirus). Virus-rich supernatant was collected at 72 hr post-transfection ...
-
bioRxiv - Cancer Biology 2022Quote: All lentiviruses were produced by co-transfection of HEK 293T/17 cells with plasmid DNA for the respective lentiviral vector and the packaging components psPAX2 and pMD2.G at a 5:3:2 mass ratio (vector:psPAX2:pMD2.G) using TransIT-LT1 (Mirus MIR 2300). Lentiviral supernatants were collected at 48 and 72 hours post-transfection ...
-
bioRxiv - Cancer Biology 2023Quote: All lentiviruses were produced by co-transfection of HEK 293T/17 cells with plasmid DNA for the respective lentiviral vector and the packaging components psPAX2 and pMD2.G at a 5:3:2 mass ratio (vector:psPAX2:pMD2.G) using TransIT-LT1 (Mirus MIR 2300). Lentiviral supernatants were collected at 48 and 72 hours post-transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 ug plasmid DNA and 3 uL TransIT-LT1 transfection reagent (Mirus, Cat#2300) were diluted in 100 uL Opti-MEM Reduced-Serum Medium (Gibco ...
-
Membrane integration and topology of RIFIN and STEVOR proteins of the Plasmodium falciparum parasitebioRxiv - Biochemistry 2019Quote: ... and 5 μl Trans-IT®LT-1 transfection reagent (Mirus, USA) for 20 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bait and prey plasmids containing fused fragments were then individually transfected together with VSVG and gag/pol packaging vectors in a ratio of 3:1:1 into HEK293T cells using Trans-IT Transfection reagent (Mirus) to produce retroviruses ...
-
bioRxiv - Biochemistry 2021Quote: ... and 1 μg of PiggyBac transposase expression vector (total = 3 μg) using TransIT-LT1 (Mirus Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... and a Venus-tagged N-terminal β-arrestin2 using 3:1 ratio of TransiT-2020 (Mirus). 5-HT2A receptor mutants were designed and performed using Q5 mutagenesis kit (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3:1 volume:mass ratio of Mirus TransIT®-LT1 transfection reagent (Mirus Bio LLC, Madison WI) to DNA ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg pre-miR-181a-1 were labeled with cy3 using Nucleic Acid Labeling Kit (Mirus) following the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2021Quote: ... and 1 μg of PiggyBac transposase expression vector (total = 3 μg) using TransIT-LT1 (Mirus Bio, Madison, WI, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... at a dye:basepair ratio 1:5 using the Mirus Label IT Nucleic Acid Labeling Kit (Mirus Bio).
-
bioRxiv - Cancer Biology 2021Quote: ... Lentiviral vectors were co-transfected with packaging vectors VSVG and gag/pol in a ratio of 3:1:2 into HEK293T cells using Trans-IT Transfection reagent (Mirus). Viral supernatants were collected at 48 and 72 hr post-transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were plated in 6-well dishes and transfected with mEGFP-tagged DNAJC17 or deletion mutants using TransIt-LT1 reagent at a 3:1 ratio (Mirus). Cells were then trypsinized and replated on 4-well chambered coverglass (LabTek ...
-
bioRxiv - Cancer Biology 2020Quote: ... were transfected at a 4:3:1 ratio using TransIT293 reagent into T225 flasks as indicated by the manufacturer (Mirus Bio). For individual sgRNA preparations ...
-
bioRxiv - Biochemistry 2022Quote: ... Lentivirus transfer vectors were packaged by co-transfection with psPAX2 and pMD2.G (4:3:1) using TransIT-2020 (Mirus Bio) in HEK293T cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µL TransIT-LT1 transfection reagent (Mirus Bio) was mixed with 15 µL Opti-MEM (Thermo ...
-
bioRxiv - Biophysics 2022Quote: ... and 3 μL of TransIt LT1 (Mirus #MIR2305). Stable clones were selected by growing in DMEM containing 0.5 μg/μL puromycin (Sigma-Aldrich #P8833-25MG ...
-
bioRxiv - Microbiology 2020Quote: ... the cells were transfected with 1 μg of in vitro-transcribed J6/JFH-1 Rluc RNA or H77S.3/GLuc RNA using the TransIT mRNA transfection kit (Mirus Bio LLC) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... cells were transfected with 3 µg of either each GPC expression plasmid or pCAGGS empty vector using TransIT LT-1 reagent (Mirus, Madison, WI, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then transiently transfected 1 µg pTA-Luc-NL4-3 and different amounts of pEGFP-SF2 using TransIT®-LT1 transfection reagent (Mirus Bio LLC) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Plasmids for expression of kinesin-1 or any of the kinesin-6 family motors tagged with monomeric NeonGreen and an FRB domain were cotransfected into COS-7 cells with a plasmid for expression of PEX3-mRFP-FKBP or GMAP210p-mRFP-2xFKBP at a ratio of 5:1 with TransIT-LT1 transfection reagent (Mirus). Eighteen hours after transfection ...
-
bioRxiv - Microbiology 2023Quote: ... Medium was changed 24 h later to 10 ml of 5 % FBS/DMEM and changed again 48 h later to 10 ml of 5 % FBS/DMEM containing 1 µg/ml of puromycin (Mirus). Cells were incubated in selection medium for 72 h ...
-
bioRxiv - Microbiology 2022Quote: ... 3 ul of TransIT-LT1 reagent (Mirus Bio LLC) transfection agent was used per ug of DNA ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 µl Mirus TransIT-LT1 transfection reagent (Mirus #MIR2300), and up to 1 µg of plasmid DNA ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 μl of TransIT-X2® transfection reagent (Mirus Bio) was then added to the tube ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 μL of TransIT-LT1 (Mirus), and the transfection was performed as per manufacturer’s directions ...
-
bioRxiv - Cell Biology 2024Quote: ... and either 3 µl Mirus TransIT-X2 transfection reagent (Mirus #MIR6000) for hTERT-RPE1 cells ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to the cells ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to cell monolayers ...
-
bioRxiv - Cell Biology 2022Quote: ... The following day 3 µl of Mirus TransIT 2020 reagent (Mirus Bio, Madison, WI) and 1 µg of plasmid were combined in 250 µl Opti-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2019Quote: ... or Gqi5 reporter plasmid (3 μg/plate) was carried out with TransIT-X2® System (Mirus). The cells were serum-starved for 16 h ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Cell-free viruses were produced by transfection of HEK293 cells with pNL4-3 using TransIT-LT1 (Mirus) or Fugene HD (Roche ...
-
bioRxiv - Bioengineering 2022Quote: Transfection of human pancreatic MIA PaCa-2 and BxPC-3 cells was performed with TransIT-mRNA (Mirus Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... MCF10A cells were treated with an additional 750 μL of medium containing 3 μM puromycin (Mirus Bio 5940), achieving a final concentration of 1 μM (0.5 μg/mL ...
-
bioRxiv - Cell Biology 2021Quote: ... or 0.25 µg KDELR-GFP and 0.5 µg pcDNA3.1 (− ligand) diluted in 100µl Optimem and 3 µl Mirus LT1 (Mirus Bio LLC). After a further 18 h ...
-
bioRxiv - Cell Biology 2023Quote: ... in a 12-well plate overnight and plasmids (1.5 μg) were transfected using 3 μl of TransIT-LT1 (Mirus). For IP experiments ...
-
bioRxiv - Microbiology 2019Quote: ... 100ng of RIG-I agonist derived from the 3’-UTR of hepatitis C virus (55) was transfected per 1e6 cells using TransIT-mRNA transfection kit (Mirus). For stimulation of MDA5 signaling ...
-
bioRxiv - Biochemistry 2020Quote: ... The following day they were transfected with 6 μg Gag plasmid + 6 μg vector plasmid + 3 μg pCMV-Rev (to support nuclear export of vector RNA) using Transit-293 (Mirus) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... 100ng of RIG-I agonist derived from the 3’-UTR of hepatitis C virus (19) was transfected per 1e6 cells using TransIT-mRNA transfection kit (Mirus). For stimulation of MDA5 signaling ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were transiently transfected with 3 µg pE-hABCA3-eGFP plasmid (hABCA3-eGFP expression controlled by CMV promoter) in Trans-IT LT1 transfection reagent (Mirus). 48 h post-transfection the medium was removed ...
-
bioRxiv - Molecular Biology 2023Quote: ... reporter plasmid delivery (3 µg/plate for cFSHr and 0.3 µg/plate for cLHr) was carried out with TransIT-X2® System (Mirus). The cells were serum-starved for 16 h ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were co-transfected with receptor of interest and TRUPATH plasmids at 1:1:1:1 DNA ratio (receptor:Gα-RLuc8:Gβ:Gγ-GFP2) via TransIT-2020 (Mirus Cat# MIR5400). Each condition required 97 µL of room-temperature 1x Opti-MEM (Gibco Cat# 31985070) ...
-
bioRxiv - Cell Biology 2022Quote: Viral particles were produced by transfection of 293FT cells in 6-well plates with 3 μg of total DNA and 8 mL TransIT-293 Transfection Reagent (Mirus Bio) per well ...
-
bioRxiv - Biophysics 2020Quote: 1μg of recombinant Plexin-B1 FL WT pCDNA 3.1 plasmid or Plexin-B1 FL mutants pCDNA 3.1 (as described above) was transfected to 80% confluent COS 7 cells on coverslips using 3 μL Trans IT 2020 transfection reagent (Mirus Bio) for 48 hours at 37 °C ...
-
bioRxiv - Systems Biology 2021Quote: ... torque teno virus hypothetical protein or human respirovirus 3 D protein were transfected into the cells using TransIT-LT1 (Mirus Bio) according to manufacturer’s protocol ...