Labshake search
Citations for Mirus Bio :
151 - 200 of 554 citations for SARS CoV 2 Spike Glycoprotein S1 His tag Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: HEK293 cells were transiently transfected with TransIT-LT1 reagent (Mirus) with channel cDNA and hERG1a N-terminal domain cDNAs in a 2:1 ratio in co-expression experiments ...
-
bioRxiv - Bioengineering 2023Quote: ... cells were triple transfected (TransIT-Lenti, Mirus Bio, Madison, WI) with plasmids for viral packaging (psPAX2 was a gift from Didier Trono ...
-
bioRxiv - Molecular Biology 2023Quote: ... into Hek293T cells (ATCC) using transIT®-LT1 (Mirus Bio). The growth media was replenished one day later ...
-
bioRxiv - Developmental Biology 2023Quote: ... COS-7 cells were transfected with Trans-IT LT1 (Mirus) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... and co-transfected to HEK293T cells using TransIT-293 (Mirus). 48 hours after transfection ...
-
bioRxiv - Microbiology 2023Quote: HEK293T cells were transiently transfected using TransIT-LT1 (Mirus #MIR2306) according to the manufacturer’s protocol at a ratio of 3µL of transfection reagent per 1µg of DNA and the medium was replaced 24 hours post transfection ...
-
bioRxiv - Microbiology 2023Quote: 293T cells were transfected using Trans IT®-293 (Mirus) following the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... into HEK293T cells using TransIT-Lenti (Mirus Bio, Madison, WI). A 3:1 ratio of transfection reagent to total plasmid was used for all transfections ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 5ug dsRNA (TransIT-2020 reagent (Mirus)) and harvested or subjected to imaging 3 days later ...
-
bioRxiv - Biophysics 2023Quote: COS-7 cells were transfected with Trans-IT LT1 (Mirus) according to the manufacturer’s instructions and collected 48 h post-transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected using TransIT-2020 Transfection Reagent (Mirus Bio) with 1 ug of EFHD1 cDNA and 0.5 µg of mt-AEQ or cytosolic aequorin ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were seeded into 14.5 cm dishes and transfected with 40 µg pTK-SM-N100-GFP-V5 expression vector using TransIT-2020 (Mirus Bio; 1 µg DNA: 2 µL reagent), delivered in Opti-MEM ...
-
bioRxiv - Cell Biology 2019Quote: ... The cell suspension was transferred to an electroporation cuvette (Mirus Bio) and electroporation was carried out using the Nucleofector I (Amaxa ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid DNA were transfected into cells using TransIT-LT1 (Mirus Bio) with the 1:3 DNA-to reagent ratio ...
-
bioRxiv - Cell Biology 2021Quote: Lentiviral particles were produced in HEK293T cells transfected with TransIT (Mirus) using 3rd generation packing plasmids (pHDMG·G VSV ENV ...
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293T cells were transfected using TransIT-LT1 (Mirus, Madison, Wisconsin, USA) in a 2:1:1 ratio of lentiviral plasmid ...
-
bioRxiv - Neuroscience 2022Quote: ... COS-7 cells were transfected using TransIT-LT1 transfection reagent (Mirus). Cells are checked annually for mycoplasma contamination.
-
bioRxiv - Microbiology 2022Quote: ... Cells were transfected with pX458 constructs using TransIT-X2 (Mirus Bio) and GFP positive cells were sorted into 96-well plates using a FACSAria II (BD ...
-
bioRxiv - Microbiology 2022Quote: HEK293T cells were transfected using TransIT®-LT1 (Mirus, Madison, WI) reagent with indicated expression vectors ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were transfected using TransIT-X2 transfection reagent (Mirus, cat# MIR6000). In order to control for transfection efficiency cells were co-transfected with a plasmid expressing mCherry (pmCherry-C1)) ...
-
bioRxiv - Cell Biology 2022Quote: ... were co-transfected in 293T cells using TransIT-Lenti (Mirus Bio). Viral supernatants were collected at 48 hrs and 72 hrs after transfection and centrifuged at 1,000 g for 10 mins ...
-
bioRxiv - Microbiology 2020Quote: BHK-21 cells were transfected using Transit-X2 transfection reagent (Mirus), as per the manufacturer’s instructions with 500ng of each ACE2-expression construct (Sup.Table.2 ...
-
bioRxiv - Microbiology 2020Quote: BHK-21 cells were transfected using Transit-X2 transfection reagent (Mirus), as per the manufacturer’s instructions with 500ng of different ACE2-expression constructs (Sup.Table.2 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... HEK293T cells were transfected using TransIT-LT1 transfection reagent (Mirus Bio) or PEI Max ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were transfected using 20 μl of TransIT-2020 (Mirus Bio) with ...
-
bioRxiv - Microbiology 2021Quote: ... and pCAG-D12L into BHK-T7 cells using TransIT-LT1 (Mirus) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... cells were transfected 0.75 µL of TransIT-HeLaMONSTER transfection reagent (Mirus) using 190 ng of PE2-P2A-Blast plasmid DNA ...
-
bioRxiv - Cell Biology 2022Quote: ... Vectors were transfected into the cells using TranIT-X2 reagent (Mirus) according to the manufacturers protocol and grown on appropriate antibiotics to generate stable cell lines.
-
bioRxiv - Biochemistry 2023Quote: ... the cells were transfected with 1.5 μL of TransIT 2020 (Mirus) and 300 ng of plasmid DNA of interest in 50 μL of OptiMem per well ...
-
bioRxiv - Synthetic Biology 2023Quote: ... HeLa cells were transfected using the TransIT-2020 reagent (Mirus Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were reverse transfected with expression plasmids via TransIT-X2 (Mirus) at a 1:3 ratio (2.5 μg plasmid ...
-
bioRxiv - Cell Biology 2024Quote: ... 24h later cells were transfected with TransIT-2020 (Mirus, MIR 5404) as previously described (Nawara et al. ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The plated HEK293 cells were transfected using TransIT DNA transfection reagent (Mirus) following the instructions supplied by the manufacturer and incubated until use ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids were introduced into cells either by transfection using TransIT-LT1 (Mirus) according to the manufacturer’s instructions or by retroviral transduction as previously described [20] ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were transfected according to the manufacturer’s instructions using TransIT-LT1 (Mirus) at the ratio of 3 μL TransIT-LT1 to 1 μg DNA ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were transfected with plasmids using TransIT-LT1 transfection reagent (Mirus) and Opti-MEM Reduced Serum Medium (Gibco) ...
-
bioRxiv - Microbiology 2020Quote: ... and transfected into Huh7.5.1 cells using TransIT-LT1 Transfection Reagent (Mirus Bio). Subsequently ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were transfected with pX458 constructs using Mirus TransIT-X2 (Mirus Bio) and two days later GFP positive cells were single-cell sorted into 96-well plates using a Sony SH800 cell sorter ...
-
bioRxiv - Cell Biology 2020Quote: ... Individual vectors were transfected into U2OS cells using TransIT-LT1 reagent (Mirus) in Opti-MEM® (Life Technologies ...
-
bioRxiv - Biochemistry 2022Quote: ... HEK293T cells were transfected with TransIT-293 (Mirus Bio, Madison, WI, USA). HeLa cells were transfected with TransIT-HeLaMONSTER (Mirus Bio).
-
bioRxiv - Molecular Biology 2022Quote: ... co-transfection in 293GP cells with TransIT-LT1 Transfection Reagent (Mirus, 2300). Two days later ...
-
bioRxiv - Bioengineering 2020Quote: ... cells were co-transfected using LT1 reagent and protocol (Mirus Bio, MIR2306) with a plasmid containing Cas9+NLS under the CMV promoter and a plasmid containing the guide RNA CACTCACGCAAAAGGCCAGCAGG under the U6 promoter ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were transfected according to the manufacturer’s instructions using TransIT-LT1 (Mirus) at the ratio of 3 µL TransIT- LT1 to 1 µg DNA ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Cells were transfected using TransIT-LT1 transfection reagent (Mirus Bio, Madison, WI) according to the manufacturer’s recommendation (250 ng dCas12a-VPR-mCherry plasmid ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... DF-1 cells were transfected using TransIT-LT1 transfection reagent (Mirus Bio).
-
bioRxiv - Cell Biology 2019Quote: ... cells were transfected with either Fugene 6 or with TransIT-LT1 (Mirus). For knockdown experiments ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were transfected using the TransIT-CHO Transfection Kit (Mirus Bio LLC) (CHO-K1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... UR61 and URMax34 cells were transfected using the Ingenio Electroporation solution (Mirus) in an Amaxa nucleofector ...
-
bioRxiv - Cell Biology 2021Quote: ... hTERT-RPE1 cells were transfected using TransIT-LT1 transfection reagent (Mirus Bio) according to manufacturer guidelines.
-
bioRxiv - Genomics 2020Quote: ... Dharmacon) into HEK 293 cells with TransIT-X2 (mc-MIR-6003, Mirus) according to the manufacturer’s instructions with some modifications ...